archive-org.com » ORG » B » BIOLOGY-ONLINE.ORG

Total: 791

Choose link from "Titles, links and description words view":

Or switch to "Titles and links view".
  • Biology-Online • View topic - What an expression vector must have
    that can exprime proteins in mammals cells Thanks in advance Reply with quote Javedz2001 Javedz2001 Posts 6 Joined Sun Oct 11 2015 4 32 pm Sun Oct 11 2015 5 01 pm The vector must have promoter T7 lambda lac etc for E coli transcription start site and multiple cloning site for cloning your gene Your target sequence must have ATG or should come from the vector If you have

    Original URL path: http://www.biology-online.org/biology-forum/about41865.html (2016-02-17)
    Open archived version from archive


  • Biology-Online • View topic - How to perform gradient PCR?
    Reply with quote Javedz2001 Javedz2001 Posts 6 Joined Sun Oct 11 2015 4 32 pm Sun Oct 11 2015 4 54 pm The time will remain the same Set up PCR as follows FAST Cycling Conditions Temp C Time sec Initial denaturation Hot Start 95 30 Steps 1 3 are repeated through 40 cycles Step 1 95 for 10 seconds Step 2 54 70 gradient for 15 seconds Step 3

    Original URL path: http://www.biology-online.org/biology-forum/about41653.html (2016-02-17)
    Open archived version from archive

  • Biology-Online • View topic - DNA sequence, Nucleotide sequence - Sequence of 3870 nuc.
    Nucleotide sequence Sequence of 3870 nuc Wed Sep 23 2015 12 10 am Visualization of DNA sequence invented in 2015 by Polish scientist Gregory Podgorniak above sequence of 3870 nucleotides ATCCTTGTTATTGCAGTAGCTCAGTACTTGCACGTGATGGGGCGCGTACACTGGAGACACGTCTTGATATTTAA ACCTTGCTCCAGCCCGGCTACAGCAGAAGACCGCAACAGTCGTGCTGACCAGTTAGAAAGATGATATGTGCGCA GCTTTTAACAGGGTGCCCCGTGGAACAGTCCTGTCGACTACAAAGGATGCGTTATCAGTCCCACCATCTCAGCG TGTTCGCCCATTACTAAGCTACACGGCGCAATAGCGGGGGACGCGCCGCCCCCCGATAACGATCATGTTGGGTA GGGACAGTCACAACGGTCTCCTGTTTACTAACAATTCATGTCAACACGCCATCTTACATGGTGTGACTGTCTAA GGGGCGGGCGGTTTCCTACAACTCCGAAGTAATTCCCTCTGTCAGTATCACAGATGCCAAAGAATTCTATCTGA ACCAGCACAGCTAAAATACATGCTCCGTAGGCCACTTTCGCAAATCCAAATGCGATAATTTATCTTAAGACTGC ATCTGCAAACCCAGGCCCGGGGTGATAGCTCTCATCTGAATATAACGTGTGCCAAAGCGCGTGGCCGAGCTCAT TTCAAGCCAACATTCGCATGTCGTGGAAGTTCGTCACCAGGCCATAGATACTTACATAAGCCGGAAAGTACACC ATCAGGCGAGCTAGTCATCACGGTTACTGGGGATTCATGCGTGGCGACTGTTCCAAAAGTTGCCATACGGCAGG ACCTTTTATTTTCTGGTACAGACGTCACCGCAATCTTCTAACTACTAACGGCGCTAAAACTCTGCGCAAGTCAG TTGGGTCTTTCTATGATATAACATGTCGTAACTGACATTAAGAGTTGCGCGTATAACTGCGAATAGACTGCATA GCTCGTCCTAGAACTATCATGGTGTACGGCATCGCTCTGACACTTATTATTCTTGGCTCTGGCTTAATATCCCC GTCGATCCCAGCGTCTCCAAGTCGTACTTCCGTGGTTGTCATCTCATTCCCAGAGTGCGGGTCAGCGAATATCT TACGTACCCCTGCCGAAGTCGTACCCCCGAGCTTCGGTATCTCATATAGTGTCGGCGGCACGACTGGGCTCGGG AGCTCGGAAGTTGGATAAATCATATGTGACGAGTCCAGAAAGTTCAGTATAGCCTTGGTGTTTCCAATGGTTCT CATGTCGTGGCCGAAGTCGAGCTCCTCTTAGCCCGCAGGAACAAACGAGGGCTACGTACAGGGTTGTCAGTGTA ATTAAAGTATCGCCGAGACTCTAGTCGGCAGAGAAACCAGTTGGCCTGTTCCCTTCTCTACCCGACCCTCTTAC TTGTGATAATATGTACAAATTACCCGGAAAATAGAGTCGCAAATCAGACGGCAGAAGTCGTAGTATCAGTTTAT TTATTTTATCATTGACTCTGGCCGTAGTACTTTTTCGTCGGTTACCCCCTGCTGATCCTGAAACGAACCCACAC GAAAGTTCTAGCGAAACAGCGGATCTGCGCCCCGTTTTGGGTACGGTGTAATTGTACGCCTGAACTGATACGGC ACAGGTCGGTTCAATCCGTTTCCCCGGATCTCACGTCATAGGACCTATGAGTAGGTAGGTCTTAAAAGATAATG ATTCTGAGGGCTATCACAGCATAATTATTTGTTACAGACGACATTCTCATATTTTCCTGCTTTGCAGGAAAGAG TATTGAACCGCTGAGGAATTACCCACGTGTTGCCAGGCAAGAGACGGCCAGGAATCGCCACGGATTGGGCACAT GACGTCGCGGACAACCCAGAATTGTCTTGAGCGATGGTAAGATCTAACCTCACTGCCGGGGGAGGCTCATACCT GGGGCTTTACTGATGTCATACCGTCTTGCACGGGGATAGAATGACGGTGCCCGTGTCTGCTTGCCTCGAAGCAA TTTTCTGAAAGTTACAGACTTCGATTAAAAAGATCGGACTGCGCGTGGGCCCGGAGAGACATGCGTGGTAGTCA TTTTTCGACGTGTCAAGGACTCAAGGGAATAGTTTGGCGGGAGCGTTACAGCTTCAATTCCCAAAGGTCGCAAG ACGATAAAATTCAACTACTGGTTTCGGCCTAATAGGTCACGTTTTATGTGAAATAGAGGGGAACCGGCTCCCAA ATCCCTGGGTGTTCTATGATAAGTCCTGCTTTATAACACGGGGCGGTTAGGTTAAATGACTCTTCTATCTTATG GTGATCCAAGCGCCCGCTAATTCTGTTCTGTTAATGTTCATACCAATACTCACATCACATTAGATCAAAGGATC CCCGAGCCCAGTCGCAAGGGTCTGCTGCTGTTGTCGACGCCTCATGTTACTCCTGGAATCTACCTGCCCTCCCC TCACCGGTTAAGGCGTGTGATCGACGATGCAGGTATACATCGGCTCGGACCTACAGTGGTCGATCGACTGGCTA CTGGCTTCGCGGTTCGGCGCGTAGTTGAGTGCGATAACCCAACCGGTGGCAAGTAGCAAGAAGACCTACCTGGG TCACCTTAGACAACCTAACTAATAGTCTCTAACGGGGAATTACCTTTACCAGTCTCATGCCTCCAATATATCTG CACCGCTTCAATGATATCGCCCACAGAAAGTAGGGTCTCAGGTATCGCATACGCCGCGCCCGGGTCCCAGCTAC GCTCAGGACGACAGTAGAGAGCTATTGTGTAATTCAGGCTCAGCATTCATCGACCTTTCCTGTTGTGAATATTG TGCTAATGCATCTCGTCCGTAACGATCTGGGGGGCAAAACCGAATATCCGTATTCTCGTCCTACGGGTCCACAA TGAGAAAGTCCTGCGCGTGATCGTCAGTTAAGTTAAATTAATTCAGGCTACGGTAAACTTGTAGTGAGCTAAGA ATCACGGGAATCACGGGTTCGCTACAGATGAACTGAATTTATACACGGACAACTCATCGCCCATTTGGGCGTGG GCACCGCAGATCAAAAGTGGCAGATTAGGAGTGCTTGATCAGGTTAGCAGGTGGACTGTATCCAACAGCGCATC AAACTTCAATAAATCCAAAGCGTTGTAGTGGTCTAAGCACCCCTGAACAGTGGCGCCCATCGTTAGCGTAGTAC AACCCTTCCCCCTTGAGGTGCGACATGGGGCCAGTTAGCCTGCCCTATATCCCTTGCACACGTTCAATAAGAGG GGCTCTACAGCGCCGCTTTTTAAATTAGGATGCCGACCCCATCATTGGTAACTGTATGTTCATAGATATTTCTT CAGGAGTAATAGCGACAAGCTGACACGCAAGGGTCAACAATAATTTCTACTATCACCCCGCTGAACGACTGTCT TTGCAAGAACCAACTGGGCTTAGATTCGCGTCCTAACGTAGTGAGGGCCGAGTCATATCATAGATCAGGCATGA GAAACCGACGTCGAGTCTACACACGAGTTGTAAACAACTTGATTGCTATACTGTAGCTACCGCAAGGATCTCCT ACATCAAAGACTACTGGGCGATCTGGATCCGAGTCAGAAATACGAGTTAATGCAAATTTACGTAGACCGGTGAA AACACGTGCCATGGGTTGCGTAGACCGTAGTCAGAAGTGTGGCGCGCTATTCGTACCGAACCGGTGGAGTATAC AGAATTGCTCTTCTACGACGTAAGGAGCTCGGTCCCCAATGCACGCCAAAAAAGGAATAAAGTATTCAAACTGC GCATGGTCCCTCCGCCGGTGGCACTATTATCCATCCGAACGTTGAACCTACTTCCTCGGCTTATGCTGTCCTCA ACAGTATCGCTTATGAATCGCATGCGGCTGTGGATCTTAACGGCCACATTCTTAATTCCGACCGATCACCGATC GCCTTTCCTCGCTGGTACAATG see site V DNA nucleotide sequence numeral system http studia scienceontheweb net visualization php Reply with quote SystemRGB SystemRGB Posts 12 Joined Fri Nov 14 2014 11 33 pm Re DNA sequence Nucleotide sequence Sequence of 3870 nuc Wed Sep 23 2015 2 38 am whole sequence Reply with quote SystemRGB SystemRGB Posts 12 Joined Fri Nov 14 2014 11 33 pm Re DNA sequence Nucleotide sequence Sequence of 3870 nuc Wed Oct 07 2015 12 26 pm This type of sequence can be a recording of complete genome of ssDNA single stranded DNA virus For example Porcine circovirus 1 from the genus Circovirus has a single chain genome of 1759 nucleotides long Post a reply Jump

    Original URL path: http://www.biology-online.org/biology-forum/about42940.html (2016-02-17)
    Open archived version from archive

  • Biology-Online • View topic - The search for the most comprehensive off-target prediction
    search for the most comprehensive off target prediction Tue Sep 29 2015 9 11 am Hello everybody I would like to call the collective knowledge for help I m looking for trusty online tool s that can achieve off target prediction to both sequence level and mRNA siRNA thermodynamic feature I would like to test 22 bp artificial miRNA candidates Thanks for reading my lines Dave Post a reply Jump

    Original URL path: http://www.biology-online.org/biology-forum/about42967.html (2016-02-17)
    Open archived version from archive

  • Biology-Online • View topic - Silencing telomeres via siRNA
    Joined Sun Sep 20 2015 9 03 pm Silencing telomeres via siRNA Sun Sep 20 2015 9 05 pm Dear all I have a question for homework and I literally have no clue is it possible to silence a telomeric site via siRNA I d say yes but I m not sure Post a reply Jump to Select a forum General Biology General Discussion Cell Biology Molecular Biology Zoology Discussion

    Original URL path: http://www.biology-online.org/biology-forum/about42932.html (2016-02-17)
    Open archived version from archive

  • Biology-Online • View topic - ATPase and temperature
    go up to it s Vmax So what about experiments to determine activity with specific substrates Example http www ncbi nlm nih gov pubmed 215034 What if more ATP was added at the above experiment Also I was reading a book about organs and cells at low temperatures and it writes even if an adequate reserve of ATP is maintained the membrane pumps are unable to utilize ATP at low

    Original URL path: http://www.biology-online.org/biology-forum/about42921.html (2016-02-17)
    Open archived version from archive

  • Biology-Online • View topic - Kunkel Random Mutagenesis for Library Creation
    in the CDR of an antibody The general Kunkel protocol for site directed mutagenesis for changing codon A to codon B I understand but not this random mutagenesis bit How are degenerate codons NNS in the primers of Kunkel random mutatgenesis for library creation used to incorporate random mutations coding for all other 19 amino acids at selected hotspot s Is this taking advantage of error prone PCR or some

    Original URL path: http://www.biology-online.org/biology-forum/about42906.html (2016-02-17)
    Open archived version from archive

  • Biology-Online • View forum - Molecular Biology
    Specific Primers 0 Sat Feb 13 2016 12 13 pm Urgent help req on Bismark 0 Wed Feb 03 2016 6 34 pm ammonium and sulphates 1 Wed Feb 03 2016 4 37 am My Multiplex PCR reaction works but not my single rxn 2 Thu Jan 28 2016 8 51 pm Glucose 0 Wed Jan 20 2016 8 28 pm Cell volume and reciprocal cell volume calculations whaaat 0 Thu Jan 07 2016 11 27 am HFQ Protein from bacteria 3 Sat Jan 02 2016 7 55 pm Brunner Syndrome could truncated MAO protein cause problem 1 Sat Dec 19 2015 5 21 pm Why is TSH reported in mIU l 4 Thu Dec 10 2015 4 46 pm Define microbicidal 0 Mon Dec 07 2015 3 41 pm Method for enhancing solubility of recombinant protein 0 Tue Nov 10 2015 5 59 am Describe the difference between these terms 0 Sun Nov 08 2015 8 05 pm most complex abiotic nonliving molecules 3 Wed Nov 04 2015 5 10 pm Ni NTA Columns 4 Thu Oct 15 2015 9 13 am experiences with ni affinity protein purification 3 Thu Oct 15 2015 9 04 am Total protein concentration before Elisa 1 Thu Oct 15 2015 7 30 am Restriction Digesion 4 Sun Oct 11 2015 5 19 pm TAE Buffer preparation 1 Sun Oct 11 2015 5 14 pm What an expression vector must have 1 Sun Oct 11 2015 5 01 pm How to perform gradient PCR 1 Sun Oct 11 2015 4 54 pm DNA sequence Nucleotide sequence Sequence of 3870 nuc 2 Wed Oct 07 2015 12 26 pm The search for the most comprehensive off target prediction 0 Tue Sep 29 2015 9 11 am Silencing telomeres via siRNA 0 Sun Sep 20 2015

    Original URL path: http://www.biology-online.org/biology-forum/forum-1.html?mobile=mobile (2016-02-17)
    Open archived version from archive



  •