archive-org.com » ORG » B » BIOLOGY-ONLINE.ORG

Total: 791

Choose link from "Titles, links and description words view":

Or switch to "Titles and links view".
  • Biology-Online • View topic - Is talent inherited?
    is it another exception under elusive equal cerebral health That s just one example There could be higher concordance rate of handedness among identical twins than among fraternal twins Twin studies on even the most culturally unique variables usually estiamte that about 30 of our variability is due to genetic variability Reply with quote wildfunguy wildfunguy Posts 109 Joined Sat Feb 18 2012 4 28 am Re Wed Oct 22 2014 1 35 am Banderi wrote P S I m not lurking 24 7 I was just happening to check for answers at the right moment Oh I thought you were stalking me Reply with quote Banderi Banderi Posts 7 Joined Sun Sep 14 2014 11 03 pm Wed Oct 22 2014 2 46 pm I still don t get the twins example but I think he mistype d wildfunguy wrote Banderi wrote P S I m not lurking 24 7 I was just happening to check for answers at the right moment Oh I thought you were stalking me Oh Looks like you got me I m afraid I m going to have to finish this once and for all Mr Wildfunguy Reply with quote RZachary1 RZachary1 Posts 9 Joined Tue Jan 13 2015 12 58 pm Location USA Website Re Is talent inherited Wed Jul 15 2015 7 20 am i don t think so it can be inherited it is purely god gifted If talent inherit through genetics then every talented person has so many talented child Reply with quote Banderi Banderi Posts 7 Joined Sun Sep 14 2014 11 03 pm Re Is talent inherited Tue Jul 21 2015 7 05 am That s why it s not inherited nor innate You can only get it through hard work Reply with quote fanbrits fanbrits Posts 4

    Original URL path: http://www.biology-online.org/biology-forum/about662-36.html (2016-02-17)
    Open archived version from archive

  • Biology-Online • View topic - human genome online database
    mutations in the average human genome This means we can make a diff file of just the places where any given individual differs from the normal reference genome In practice this is usually done in a VCF file format which in its simplest format looks something like so chr20 14370 rs6054257 G A 29 PASS 0 0 Where each line uses 45 bytes and you times this by the 3 million variants in a given genome and you get a VCF file size of about 135 000 000 bytes or 125 megabytes is that correct do you know a database to download a VCF file or something similar Itll be amazing if you could provide a link to a file metioned above Cheers Sarah Reply with quote claudepa claudepa Posts 27 Joined Tue Nov 03 2015 12 43 pm Re human genome online database Sat Jan 02 2016 8 24 pm Hi I hope a bioinformatician will give you the answer What I read is similar to what you have read 0 1 difference between two individuals This is called polymorphism and can be used to identify predisposition to diseases On average 1000 bases are similar before one base is different This is only average since there are DNA hypervariable regions that are for instance used by forensic biology to indentify people Nevetheless I heard also that with the exception of true twins there are no individuals with the same DNA sequence and there will never be I believe that for chimpanzees and human 100 bases are similar before one base is different Also surprising I have always been puzzled by the fact that there is such a similarity of DNA sequence between two humans and so many differences particularly at the brain level It probably means that genetics is

    Original URL path: http://www.biology-online.org/biology-forum/about43281.html (2016-02-17)
    Open archived version from archive

  • Biology-Online • View topic - Leukemia - Blood Cancer.
    12 10 pm Is Leukemia Blood Cancer a hereditary or genetic Disease Thanks Regards Prashant S Akerkar Reply with quote sherrycd sherrycd Posts 2 Joined Wed Oct 14 2015 2 05 am Wed Nov 04 2015 5 56 am Nope But if parents are with leukemia their children are susceptible Genetic is only one possible reason for leukemia Hope this is useful for you Sherry Reply with quote claudepa claudepa Posts 27 Joined Tue Nov 03 2015 12 43 pm Re Leukemia Blood Cancer Wed Nov 04 2015 5 43 pm Hi Generally speaking cancers are caused by DNA mutations Most of time these mutations are not hereditary It means that they occur during our life after birth The consequence is that the older we are the greater the chance to have a cancer But sometimes it can be inherited For breast cancer for instance mutations are known on brca1 and brca2 genes which are hereditary However they concern only 5 of breast cancers Usually for brca1 and brca2 hereditary mutations there is an abnormal number of breast cancers in a family and doctors specialized in genetic are then looking for the presence of these mutations Post a reply Jump

    Original URL path: http://www.biology-online.org/biology-forum/about42988.html (2016-02-17)
    Open archived version from archive

  • Biology-Online • View topic - Pacbio Rs or NGS?
    need to sequence my tetraploid moringa oleifera so I tried to find a company which provide NGS But finally they recommend Pacbio Rs http www cd genomics com PACBIO RS II html and said this is more suitable for tetraploid plants I could not make a decision so I was wondering if anyone here know information about Pacbio Rs and could give me some suggestion Thanks Post a reply Jump

    Original URL path: http://www.biology-online.org/biology-forum/about43069.html (2016-02-17)
    Open archived version from archive

  • Biology-Online • View topic - Associate Specialist Step I-IV - Genetics, Genomics and Deve
    and researchers in the use of microscopes Perform routine maintenance and re alignment optimization on various imaging systems PALM STORM Multifocus microscope light sheet microscope epi fluoresence Train and assist users with their imaging tasks Participate in the design development and alignment of new imaging systems General organization and management of imaging facilities inventory ordering safety record keeping etc Minimum Basic Qualifications Required By the time of application Bachelor s degree or equivalent degree in Biological Science Physics Engineering or related field Applicant must have 4 5 years of experience in a laboratory setting Additional Qualifications by start date Theory and hands on experience with Super localization microscopy PALM STORM TIRF light sheet FISH adaptive optics Experience with commercial microscopes and control and image analysis software e g micromanager Elements ImageJ Labview Matlab Python Optical system design alignment and integration Ability to work on a large number of projects simultaneously Ability to talk to various sales representatives and manage large orders Must be able to lift and maneuver at least 40lbs of weight and work in tight places Preferred Qualifications by start date Master s degree or equivalent degree in Molecular and Cell Biology Biology or a related field Experience in Tissue culture and specimen preparation Live cell Imaging Experience with programming C Labview MATLAB python Experience with electronics make simple circuits soldering wiring etc Appointment This appointment will report to Xavier Darzacq 100 for 1 year with expectation of extension based on performance and availability of funding The approximate start date of this position will be January 2 2016 Salary 52 344 63 012 depending on qualifications This position provides full benefits To Apply http apptrkr com 691763 Interested individuals should submit application documents as PDFs which includes an updated curriculum vitae and names with contact information for at

    Original URL path: http://www.biology-online.org/biology-forum/about43024.html (2016-02-17)
    Open archived version from archive

  • Biology-Online • View topic - Visualization of sequences of nucleotides, sequence of DNA
    Nov 14 2014 11 33 pm Re Visualization of sequences of nucleotides sequence of D Sun Aug 02 2015 10 31 pm Sequence of 744 nucleotides GCGGCTTCCTACCTTTAGCTCCGAGTATAGTGAGGCCTAGATATGCGCGGGCAGGTAGCTACAGTGTATACATG CTCGTTCTGCGGCATGCGGATATAAATTAAGGATAATACTCAAGTGTTCCAGGGGAGCAGTCATAAAGCACAAC TTCATTATCCCTAAGCTCAGTTAATCTAAGCATGTTTAGCGCTAAGTCTCGTCTACGCGGCAAATACTTTGTAA GCGTTTCTTTAACTTGCCGCTCTCAGAAGGGGCACGGCCGTCATTATGTAACAAGAACGAGTCTCTTACTGGTT GTGCGAGTGGAATGGAGCAACGATGTACGTGTACCGGAAATTTCTAAGGTTTCCCGGCGTATCGATCAAGTCCA GGTTACCGCCTCCCGACAAGGGTATGCTCAACATCCACTGCTGCTGTCCTACGCTCCCTTGGAGACCAATCCTG CGTCATTCAAACTTCGAACATGCGCCGGCATTGTATGTTCATGCCGATAGTGGGTTCATGTTGTGTTATTTACA TTCACTGAGTGGCTTCTGCATGTTTCTGGCTCGCCCGAGACTGATCACGCAAAAAATCTCAGAGATGAACTCAA CTGTACCCGTATAATTGGACCAAAGCTGTCGCGCAGCCGTTACGTGCGTATAGTAAATCCAATTTGCTGCAAAT TCAACAAAAAAGACAGGCTCACGATGCGACGATATTTTGATAATTTTCTAGCGGGCTCGGCCAGCGTACAGTGA GAGTTTACTGGTGGCGGCGCTGCTAACACGAGTT Reply with quote SystemRGB SystemRGB Posts 12 Joined Fri Nov 14 2014 11 33 pm Re Visualization of sequences of nucleotides sequence of D Wed Aug 05 2015 1 37 pm Reply with

    Original URL path: http://www.biology-online.org/biology-forum/about42077.html (2016-02-17)
    Open archived version from archive

  • Biology-Online • View topic - Odd diploid number?? (Indian muntjac)
    2n of 6 for the female wow especially since another subspecies has 46 and 7 for the male confused I know many insect sexes have different chromosome numbers but I didn t know it happened in mammals I also didn t know mammals could have an odd number of chromosomes I was under the impression that to form gametes you needed an even number thus why mules and triploid bananas

    Original URL path: http://www.biology-online.org/biology-forum/about42062.html (2016-02-17)
    Open archived version from archive

  • Biology-Online • View topic - biology question about chromosomes
    Wed Jul 12 2006 2 45 pm I think I answered my own question Anything else I ve missed Reply with quote biotchr biotchr Posts 77 Joined Sun Feb 05 2006 5 28 am Wed Jul 12 2006 2 45 pm And is it possible for an organism to have an odd number of chromosomes Reply with quote canalon canalon Posts 3909 Joined Thu Feb 03 2005 2 46 pm Location Canada Wed Jul 12 2006 4 54 pm Yep you pretty much made questions and answers And rightly so As for the odd number of chromosome you find it in all prokaryotes It is usually one but some bacteria have more than one Reply with quote biotchr biotchr Posts 77 Joined Sun Feb 05 2006 5 28 am Thu Jul 13 2006 4 53 am Canalon wrote Yep you pretty much made questions and answers And rightly so As for the odd number of chromosome you find it in all prokaryotes It is usually one but some bacteria have more than one Thanks biotchr Reply with quote Jelanen Jelanen Posts 218 Joined Fri Mar 04 2005 1 00 am Location The Lab Tue Jul 18 2006 10 05 pm Some organisms use the presence or lack of a chromosome to determine sex I m sitting at work apart from my texts and I don t deal with this stuff on a daily basis anymore sigh but I seem to recall drosophila determine sex this way someone correct me or something here Reply with quote xand 3r xand 3r Posts 32 Joined Thu Aug 04 2005 6 52 pm Location Romania Wed Jul 19 2006 11 06 am Yes there are organisms that have an odd number of chromosomes but they can t reproduce For example some type of roses

    Original URL path: http://www.biology-online.org/biology-forum/about7014.html (2016-02-17)
    Open archived version from archive



  •