archive-org.com » ORG » B » BOTANY.ORG

Total: 33

Choose link from "Titles, links and description words view":

Or switch to "Titles and links view".
  • American Journal of Botany - Supplementary Data Site
    are available for Volume 87 2000 Volume 88 2001 Volume 89 2002 Volume 90 2003 ALL CURRENT SUPPLEMENTAL DATA ARE AVAILABLE ONLINE AT THE AMERICAN JOURNAL OF BOTANY ONLINE SITE

    Original URL path: http://ajbsupp.botany.org/ (2016-02-14)
    Open archived version from archive


  • American Journal of Botany - Supplementary Data Site - 2000
    data link Abstract Full Text September JAMES E RICHARDSON MICHAEL F FAY QUENTIN C B CRONK DIANE BOWMAN and MARK W CHASE A phylogenetic analysis of Rhamnaceae using rbcL and trnL F plastid DNA sequences Am J Bot 2000 87 1309 1324 PAUP file data link Abstract Full Text GEORGE D WEIBLEN Phylogenetic relationships of functionally dioecious FICUS Moraceae based on ribosomal DNA sequences and morphology Am J Bot 2000 87 1342 1357 PAUP file data link Abstract Full Text December ANNETTE M KRETZER MARTIN I BIDARTONDO LISA C GRUBISHA JOSEPH W SPATAFORA TIMOTHY M SZARO AND THOMAS D BRUNS Regional specialization of Sarcodes sanguinea Ericaceae on a single fungal symbiont from the Rhizopogon ellenae Rhizopogonaceae species complex Am J Bot 2000 87 1778 1782 PAUP file data link Abstract Full Text W MARK WHITTEN NORRIS H WILLIAMS AND MARK W CHASE Subtribal and generic relationships of Maxillarieae Orchidaceae with emphasis on Stanhopeinae combined molecular evidence Am J Bot 2000 87 1842 1856 PAUP file data link Abstract Full Text Instructions for Specific File Types PAUP Phylogenetic Analysis Using Parsimony PAUP is a software package used by systematists for the inference of evolutionary trees PAUP files are saved on this

    Original URL path: http://ajbsupp.botany.org/v87/ (2016-02-14)
    Open archived version from archive

  • American Journal of Botany - Supplementary Data Site 2001
    Article Abstract Full Text JESPER KÅREHED 2001 Multiple origins of the tropical forest tree family Icacinaceae American Journal of Botany 88 2259 2274 Appendix 1 Specimen vouchers WORD file PDF file Appendix 2 Alignment gaps inserted in the ndhF matrix WORD file PDF file Appendix 3 Accession numbers in the EMBL GenBank archives WORD file PDF file Appendix 4 Morphological data matrix WORD file PDF file Article Abstract Full Text ALAN W MEEROW AND DEIRDRE A SNIJMAN Phylogeny of Amaryllidaceae tribe Amaryllideae based on nrDNA ITS sequences and morphology American Journal of Botany 88 2321 2330 Appendix Specimen voucher DNA sequence alignments WORD file PDF file Article Abstract Full Text URSULA PEINTNER NEALE L BOUGHER MICHAEL A CASTELLANO JEAN MARC MONCALVO MEINHARD M MOSER JAMES M TRAPPE AND RYTAS VILGALYS 2001 Multiple origins of sequestrate fungi related to Cortinarius Cortinariaceae American Journal of Botany 88 2168 2179 Appendix Specimen vouchers DNA sequence alignments WORD file PDF file Article Abstract Full Text LI BING ZHANG HANS PETER COMES AND JOACHIM W KADEREIT 2001 Phylogeny and quaternary history of the European montane alpine endemic Soldanella Primulaceae based on ITS and AFLP variation American Journal of Botany 88 2331 2345 Appendix Specimen vouchers DNA sequence alignments WORD file PDF file Article Abstract Full Text Instructions for Specific File Types ASCII Text Standard US Text File Type ASCII text is raw unformatted text using the ASCII character set These pages may be viewed using your internet browser by simply clicking on the link After the file is loaded into the brower if you wish to save the file use the Save As feature of the browser located under the File header of the browser PDF Document Portable Document Format PDF Portable Document Format is a proprietary format of Adobe Acrobat Acrobat Reader is available

    Original URL path: http://ajbsupp.botany.org/v88/ (2016-02-14)
    Open archived version from archive

  • American Journal of Botany - Supplementary Data Site 2002
    data in Osmorhiza Apiaceae American Journal of Botany 89 6 966 971 Appendix Specimen vouchers GenBank data WORD file PDF file Article Abstract Full Text July SYLVAIN G RAZAFIMANDIMBISON AND BIRGITTA BREMER 2002 Phylogeny and classification of Naucleeae s l Rubiaceae inferred from molecular ITS rbcL and trnT F and morphological data American Journal of Botany 89 7 1027 1041 Appendix Specimen vouchers GenBank data WORD file PDF file Article Abstract Full Text EVE EMSHWILLER AND JEFF J DOYLE 2002 Origins of domestication and polyploidy in oca Oxalis tuberosa Oxalidaceae 2 Chloroplast expressed glutamine synthetase data American Journal of Botany 89 7 1042 1056 Appendices 1 alignment of ncPGS DNA sequences PDF file 2 Indel differences among ncpGS sequences of sampled Oxalis taxa WORD file PDF file 3 Specimen vouchers GenBank data WORD file PDF file Article Abstract Full Text COLIN E HUGHES C DONOVAN BAILEY AND STEPHEN A HARRIS 2002 Divergent and reticulate species relationships in Leucaena Fabaceae inferred from multiple data sources insights into polyploid origins and nrDNA polymorphism American Journal of Botany 89 7 1057 1073 Appendices 1 Specimen vouchers GenBank data WORD file PDF file 2 Data matrix of combined cpDNA ITS and morphology ASCII file 3 Data matrix for cpDNA ASCII file 4 Data matrix for ITS ASCII file 5 cpDNA data WORD file PDF file Article Abstract Full Text JASON T RAUSCHER 2002 Molecular phylogenetics of the Espeletia complex Asteraceae I Evidence from nrDNA ITS sequences on the closest relatives of an Andean adaptive radiation American Journal of Botany 89 7 1074 1084 Appendix Specimen vouchers GenBank data WORD file PDF file Article Abstract Full Text PAUL M BEARDSLEY AND RICHARD G OLMSTEAD 2002 Redefining Phrymaceae the placement of Mimulus tribe Mimuleae and Phryma American Journal of Botany 89 7 1093 1102 Appendices 1 Specimen vouchers GenBank data Excel file PDF file 2 Data matrix PAUP file Article Abstract Full Text RAYMUND CHAN BRUCE G BALDWIN AND ROBERT ORNDUFF 2002 Cryptic goldfields a molecular phylogenetic re investigation of Lasthenia californica sensu lato and close relatives Compositae Heliantheae sensu lato American Journal of Botany 89 7 1103 1112 Appendices 1 Specimen vouchers GenBank data WORD file PDF file Article Abstract Full Text ELENA TORRES JOSÉ M IRIONDO AND CÉSAR PÉREZ 2002 Vulnerability and determinants of reproductive success in the narrow endemic Antirrhinum microphyllum Scrophulariaceae American Journal of Botany 89 7 1171 1179 Appendix Specimen vouchers GenBank data WORD file PDF file Article Abstract Full Text August ANDREW N DOUST AND ELIZABETH A KELLOGG 2002 Inflorescence diversification in the panicoid bristle grass clade Paniceae Poaceae evidence from molecular phylogenies and developmental morphology American Journal of Botany 89 8 1203 1222 Appendix Specimen vouchers GenBank data WORD file PDF file Article Abstract Full Text AUSTIN R MAST AND THOMAS J GIVNISH 2002 Historical biogeography and the origin of stomatal distributions in Banksia and Dryandra Proteaceae based on their cpDNA phylogeny American Journal of Botany 89 8 1311 1323 Appendix Specimen vouchers GenBank data WORD file PDF file Article Abstract Full Text CAROLYN J FERGUSON AND ROBERT K JANSEN 2002 A chloroplast DNA phylogeny of eastern Phlox Polemoniaceae implications of congruence and incongruence with the ITS phylogeny American Journal of Botany 89 8 1324 1335 Appendix 1 Specimen vouchers GenBank data WORD file PDF file 2 Chloroplast DNA restriction site data WORD file PDF file 3 Matrix for chloroplast DNA restriction site data WORD file PDF file Article Abstract Full Text ROB D SMISSEN JOHN C CLEMENT PHIL J GARNOCK JONES AND GEOFFREY K CHAMBERS 2002 Subfamilial relationships within Caryophyllaceae as inferred from 5 ndhF sequences American Journal of Botany 89 8 1336 1341 Appendix Specimen vouchers GenBank data WORD file PDF file Article Abstract Full Text J CHRIS PIRES AND KENNETH J SYTSMA 2002 A phylogenetic evaluation of a biosystematic framework Brodiaea and related petaloid monocots Themidaceae American Journal of Botany 89 8 1342 1359 Appendix Specimen vouchers GenBank data WORD file PDF file Article Abstract Full Text September RODGER C EVANS AND CHRISTOPHER S CAMPBELL 2002 The origin of the apple subfamily Maloideae Rosaceae is clarified by DNA sequence data from duplicated GBSSI genes American Journal of Botany 89 9 1478 1484 Appendix 1 Alignment of exons bold face type and introns WORD file PDF file Appendix 2 Specimen vouchers GenBank data WORD file PDF file Article Abstract Full Text JOSÉ AQUILEO LOMELÍ SENCIÓN AND EDUARDO SAHAGÚN GODÍNEZ 2002 Rediscovery of Pedilanthus coalcomanensis Euphorbiaceae a threatened endemic Mexican species American Journal of Botany 89 9 1485 1490 Appendix Specimen data WORD file PDF file Article Abstract Full Text KENNETH M CAMERON KENNETH J WURDACK AND RICHARD W JOBSON 2002 Molecular evidence for the common origin of snap traps among carnivorous plants American Journal of Botany 89 9 1503 1509 Appendix Specimen vouchers GenBank data WORD file PDF file Article Abstract Full Text SASA STEFANOVIC LORI KRUEGER AND RICHARD G OLMSTEAD 2002 Monophyly of the Convolvulaceae and circumscription of their major lineages based on DNA sequences of multiple chloroplast loci American Journal of Botany 89 9 1510 1522 Appendix Specimen vouchers GenBank data WORD file PDF file Article Abstract Full Text KENNETH J SYTSMA JEFFERY MORAWETZ J CHRIS PIRES MOLLY NEPOKROEFF ELENA CONTI MICHELLE ZJHRA JOCELYN C HALL AND MARK W CHASE 2002 Urticalean rosids circumscription rosid ancestry and phylogenetics based on rbcL trnL F and ndhF sequences American Journal of Botany 89 9 1531 1546 Appendix Specimen vouchers GenBank data WORD file PDF file Article Abstract Full Text October W JOHN KRESS LINDA M PRINCE AND KYLE J WILLIAMS 2002 The phylogeny and a new classification of the gingers Zingiberaceae evidence from molecular data American Journal of Botany 89 10 1682 1696 Appendix Specimen vouchers GenBank data WORD file PDF file Article Abstract Full Text ESTEBAN BORTIRI SANG HUN OH FANG YOU GAO AND DAN POTTER 2002 The phylogenetic utility of nucleotide sequences of sorbitol 6 phosphate dehydrogenase in Prunus Rosaceae American Journal of Botany 89 10 1697 1708 Appendix Specimen vouchers GenBank data WORD file

    Original URL path: http://ajbsupp.botany.org/v89/ (2016-02-14)
    Open archived version from archive

  • American Journal of Botany - Supplementary Data Site 2003
    American Journal of Botany 90 4 650 657 Specimen vouchers GenBank data EXCEL file PDF file Article Abstract Full Text May A ATHANASIOU D KHOSRAVI F TAMARI AND J S SHORE 2003 Characterization and localization of short specific polygalacturonase in distylous Turnera subulata Turneraceae American Journal of Botany 90 5 675 682 Specimen vouchers GenBank data WORD file PDF file Article Abstract Full Text GREGORY J JORDAN AND MICHAEL K MACPHAIL 2003 A Middle Late Eocene inflorescence of Caryophyllaceae from Tasmania Australia American Journal of Botany 90 5 761 768 Appendix 1 Specimen vouchers GenBank data WORD file PDF file Appendix 2 GenBank data on rcbL and matK of 81 taxa in NEXUS format NEXUS data set Appendix 3 GenBank data on rcbL and matK of 160 taxa in NEXUS format NEXUS data set Article Abstract Full Text GERARDO A SALAZAR MARK W CHASE MIGUEL A SOTO ARENAS AND MARTIN INGROUILLE 2003 Phylogenetics of Cranichideae with emphasis on Spiranthinae Orchidaceae Orchidoideae evidence from plastid and nuclear DNA sequences American Journal of Botany 90 5 777 795 Specimen vouchers GenBank data WORD file PDF file Article Abstract Full Text SANDRA S ALISCIONI LILIANA M GIUSSANI FERNANDO O ZULOAGA AND ELIZABETH A KELLOGG 2003 A molecular phylogeny of Panicum Poaceae Paniceae tests of monophyly and phylogenetic placement within the Panicoideae American Journal of Botany 90 5 796 821 Specimen vouchers GenBank data WORD file PDF file Article Abstract Full Text June DIANELLA G HOWARTH MATS H G GUSTAFSSON DAVID A BAUM AND TIMOTHY J MOTLEY 2003 Phylogenetics of the genus Scaevola Goodeniaceae implications for dispersal patterns across the Pacific Basin and colonization of the Hawaiian Islands American Journal of Botany 90 6 915 923 Specimen vouchers GenBank data WORD file PDF file Article Abstract Full Text MICHAEL J SANDERSON 2003 Molecular data from 27 proteins do not support a Precambrian origin of land plants American Journal of Botany 90 6 954 956 Specimen vouchers GenBank data PAUP NEXUS file Article Abstract Full Text July J GUILLERMO SEIJO AND AVELIANO FERNÁNDEZ 2003 Karyotype analysis and chromosome evolution in South American species of Lathyrus Leguminosae American Journal of Botany 90 7 980 987 Specimen vouchers GenBank data WORD file PDF file Article Abstract Full Text ABIGAIL FROST JUAN CARLOS LÓPEZ GUTIÉRREZ AND COLIN B PURRINGTON 2003 Fitness of Cuscuta salina Convolvulaceae parasitizing Beta vulgaris Chenopodiaceae grown under different salinity regimes American Journal of Botany 90 7 1032 1037 Color illustration JPG file PDF file Article Abstract Full Text DAVID A SIMPSON CAROL A FURNESS TREVOR R HODKINSON A MUTHAMA MUASYA AND MARK W CHASE 2003 Phylogenetic relationships in Cyperaceae subfamily Mapanioideae inferred from pollen and plastid DNA sequence data American Journal of Botany 90 7 1071 1086 Specimen vouchers GenBank data WORD file PDF file Article Abstract Full Text ESTER GAYA FRANÇOIS LUTZONI STEFAN ZOLLER AND PERE NAVARRO ROSINÉS 2003 Phylogenetic study of Fulgensia and allied Caloplaca and Xanthoria species Teloschistaceae lichen forming Ascomycota American Journal of Botany 90 7 1095 1103 Specimen vouchers GenBank data WORD file PDF file Article Abstract Full Text August VLADIMIR L SEMERIKOV AND MARTIN LASCOUX 2003 Nuclear and cytoplasmic variation within and between Eurasian Larix species American Journal of Botany 90 8 1113 1123 Location of the Larix populations studied WORD file PDF file Article Abstract Full Text KELLY GRAVUER ERIC J VON WETTBERG AND JOHANNA SCHMITT 2003 Dispersal biology of Liatris scariosa var novae angliae Asteraceae a rare New England grassland perennial American Journal of Botany 90 8 1159 1167 Specimen vouchers GenBank data WORD file PDF file Article Abstract Full Text TIFFANY M KNIGHT 2003 Effects of herbivory and its timing across populations of Trillium grandiflorum Liliaceae American Journal of Botany 90 8 1207 1214 Location of the Trillium grandiflorum populations studied WORD file PDF file Article Abstract Full Text LARRY HUFFORD MICHELLE M MCMAHON ANNA M SHERWOOD GAIL REEVES AND MARK W CHASE 2003 The major clades of Loasaceae phylogentic analysis using the plastid matK and trnL trnF regions American Journal of Botany 90 8 1215 1228 Specimen vouchers GenBank data WORD file PDF file Article Abstract Full Text VALERIA C MUSCHNER ALINE P LORENZ ARMANDO C CERVI SANDRO L BONATTO TATIANA T SOUZA CHIES FRANCISCO M SALZANO AND LORETA B FREITAS 2003 A first molecular phylogenetic analysis in Passiflora Passifloraceae American Journal of Botany 90 8 1229 1238 Specimen vouchers GenBank data WORD file PDF file Article Abstract Full Text September HERVÉ SAUQUET 2003 Androecium diversity and evolution in Myristicaceae Magnoliales with a description of a new Malagasy genus Doyleanthus gen nov American Journal of Botany 90 9 1293 1305 Appendix A Voucher materials and generic descriptions Appendix B Discussion of character evolution WORD file PDF file Article Abstract Full Text CHUANZHU FAN AND QIU YUN JENNY XIANG 2003 Phylogenetic analyses of Cornales based on 26S rDNA and combined 26S rDNA matK rbcL sequence data American Journal of Botany 90 9 1357 1372 Specimen vouchers GenBank data WORD file PDF file Article Abstract Full Text ELIZABETH J HERMSEN MARÍA A GANDOLFO KEVIN C NIXON AND WILLIAM L CREPET 2003 Divisestylus gen nov aff Iteaceae a fossil saxifrage from the Late Cretaceous of New Jersey USA American Journal of Botany 90 9 1373 1388 Specimen vouchers collection data WORD file PDF file Article Abstract Full Text October CORNELIA KLAK ANGELINE KHUNOU GAIL REEVES AND TERRY HEDDERSON 2003 A phylogenetic hypothesis for the Aizoaceae Caryophyllales based on four plastid DNA regions American Journal of Botany 90 10 1433 1445 Specimen vouchers GenBank data EXCEL file PDF file Article Abstract Full Text MAX COLEMAN AARON LISTON JOACHIM W KADEREIT AND RICHARD J ABBOTT 2003 Repeat intercontinental dispersal and Pleistocene speciation in disjunct Mediterranean and desert Senecio Asteraceae American Journal of Botany 90 10 1446 1454 Specimen vouchers GenBank data WORD file PDF file Article Abstract Full Text ANNIKA VINNERSTEN AND GAIL REEVES 2003 Phylogenetic relationships within Colchicaceae American Journal of Botany 90 10 1455 1462 Appendix 1 Specimen vouchers GenBank data WORD file PDF file Appendix 2

    Original URL path: http://ajbsupp.botany.org/v90/ (2016-02-14)
    Open archived version from archive


  • GTTCTATGA ACGGATTCGTTTTCTTTTTT ATGAATCCATATTGATATTGATTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATATTTATT CTTCGCTTCACAATTT AGAATCAGATTTATTTTT CTTTTGTTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAAAA GGCTGGTCTTTTTTTTTT ATTTAATCTTATAACCC TAAAAAA CCAACGAGTCGCAC Pastinaca 70 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTAAAAATG TCTAT TATTCATTTGTATAG CTTGCTTTTTTAGCTAACTAAGCATATTAATATTT CTATTTTATATTTT TAAATTTATATTTTTAAATATC ATATTCTTTTTTT ATGTTCTAACGAATA TTTGTTTTT GTTTTT ATCCTAATACAAAATATTG TTGGATT GAACAAAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCGATATTTT AGTTGTA GGGTTAACTCAT GACTTTTA TTTTCCCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGCCTG ATTTCTACAACGGAGCTCATAATGAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTT GTTCTATGA ACGGATTCGTTTTATTTTTT ATGAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATATTTATT CTTCGCTTCACAATTT AGAATCAGATTTATTTTT CTTTTGTTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAAAA GGCTGGTCTTTTTTTTTT ATTTAATCTTATAACCC TAAAAAA CCAACGAGTCGCAC Pastinaca 39 GTTATAATTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTTAAAATG TCTAT TATTCATTTGTATAG CTTGCTTTTTTAGCTAACTAAGCATATTAATATTT CTATTTTATATTTT TAAATTGATATTTTTAAATATA ATATTCTTTTTTT ATGTTCTAACGAATA TTTGTTTT GTTTTT ATCCTAATACAAAATATGG TTGGATT GAGCAAAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCGATATTTT AGTTGTA GGGTTAACTCAT GACTTTTA TTTTGCCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGG TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAACGGAGCTCATAATGAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTT GTTCTATGA ACGGATTCGTTTTCTTTTTT ATGAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATATTTATT CTTCGCTTCACAATTT AGAATCAGATTTATTTTT CTTTTGTTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAAA GGCTGGTCTTTTTTTTTT ATTTAATCTTATAACCC TAAAAAA CCAACGAGTCGCAC Malabaila 253 GTTATAATTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTAAAAATG TCTAT TATTCATTTGTATAG CTTGCTTTTTTAGCTAACTAAGCATATTAATATTT CTATTTTATATTTT TAAATATA ATATTCTTTTTT ATGTTCTAACGAATA TTTGTTTT GTTATT ATCCTAATACAAAATATGG TTGGATT GAGCAAAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCGATATTTT AGTTGTA GGGTTAACTCAT GACTTTTA TTTTGCCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGG TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAACGGAGATCATAATGAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTT GTTCTATGA ACGGATTCGTTTTCTTTTTT ATGAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATATTTATT CTTCGCTTCACAATTT AGAATCAGATTTATTTTT CTTTTGTTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAAAA GGCTGGTCTTTTTTTTT ATTTAATCTTATAACCC TAAAAAA CCAACGAGTCGCAC Heracleum 511 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTAAAAATG TCTAT TATTCATTTGTATAT CTTGCTTTTTTAGCTAACTAAGCATATTAATATTT CTATTTTATATTTT TAAATATC ATATCATATTCTTTTTTT ATGTTCTAACGAATA TTTGTTTT GTTTTTCTTTTT ATCCTA TTGGATT GAGCAAAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCGCTATTTT AATTGTA GGGTTAACTCAT GACTTTTA TTTTCCCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAACGGAGCTCATAATGAAATTTTTTCTTGAGCAAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTTT GTTCTATGA ACGGATTCGTTTTCTTTTTT ATGAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATATTTCTT CTTCGCTTCACAATTT AGAATCAGATTTATTTTT CTTTTGTTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAAA GGCTGGTTTTTTTTTT ATTTAATCCTATAACCC TAAAAAA CCAACGAGTCGCAC Zozima 19 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTAAAAATG TCTAT TATTCATTTGTATAT CTTGCTTTTTTAGCTAACTAAGCATATTAATATTT CTATTTTATATTTT TAAAAATC ATATTCTTTTTTT ATGATCTAACAAATA TTTGTTTT GTTTTTCTTTTT ATCCTA TTGGATT GAGCAAAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCGCTATTTT AATTGTA GGGTTAACCCAT GACTTTTA TTTTCCCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAACGGAGCTCATAATGAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTTT GTTCTATGA ACGGATTCGTTTTCTTTTTT ATGAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATATTTCTT CTTCGCTTCACAATTT AGAATCAGATTTATTTTT CTTTTGTTT TTATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAAAA GGCTGGTCTTTTTTTTTT ATTTAATCCTATAACCC TAAAAAA CCAACGAGTCGCAC Tordylium 823 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTAAAAATG TCTAT TATTCATTTGTATAT CTTGCTTTTTTAGCTAACTAAGTAGATTAATATTT CTATTTTATATTTT TAAATATA ATATTCTTTTTTT ATGTTCTAACGAATA TTTGTTTT GTTTTTCTTTTT ATCCTA TTGGATT GAGCAAAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCGCTATTTT AATTGTA GGGTTAAATCAT GACTTTTA TTTTCCCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAACGGAGCTCATAATGAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTTTT GTTCTATGA ACGGATTCGTTTTCTTTTTT ATGAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATTTAT ATCGTTGTTTTTT CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATATTTCTT TTTCGCTTCACAATTT AGAATCAGATTTATTTTT CTTTTGTTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAAAA GGCTGGTCTTTTTTTT ATTTAATCCTATAACCC TAAAAAA CCAACGAGTCGCAC Cnidiocarpa 70 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACCGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTAAAAATG TCTAT TATTCATTTGTATAG CTTGCTTTTTTAGCTAACTAAGCATATTAATATTT CTATTTTATATTTT TAAATTGATATTTTTAAATATC ATATTCTTTTTTT ATGTTCTAACGAATA TTTGTTTT GTTTTTCTTTTT ATCCTA TTGGATT GAGCAAAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCGCTATTTT AGTTGTA GGGTTAACTCAT GACTTTTA TTTTCCCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAACGGAGCTCATAATGAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTT GTTCTATGA ACGGATTCGTTTTCTTTTTT ATGAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATATTTCTT CTTCGCTTCACAATTT AGAATCAGATTTATTTTT CTTTTGTTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATACAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAAAA GGCTGGTCTTTTTTTTTT ATTTAATCCTATAACCC TAAAAAA CCAACGAGTCGCAC Ligusticum 61 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACCGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTCAAAATG TCTAT TATTCATTTGTATAG CTTGCTTTTTTAGCTAACTAAGCATATTAATATTT CTATTTTATATTTT TAAATTGATATTTTTAAATATC ATATTCTTTTTTT ATGTTCTAACGAATA TTTGTTTT GTTTTTCTTTTT ATCCTA TTGGATT GAGCAAAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCGCTATTTT AGTTGTA GGGTTAACTCAT GACTTTTA TTTTCCCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAACGGAGCTCATAATGAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTT GTTCTATGA ACGGATTCGTTTTCTTTTTT ATGAATCCATATTTA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATATTTCTT CTTCGCTTCACAATTT AGAATCAGATTTATTTTT CTTTTGTTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATACAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAAAA GGCTGGTCTTTTTTTTTT ATTTAATCCTATAACCC TAAAAAA CCAACGAGTCGCAC Cnidium 64 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACCGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTCAAAATG TCTAT TATTCATTTGTATAG CTTGCTTTTTTAGCTAACTAAGCATATTAATATTT CTATTTTATATTTT TAAATTTTTATTTTTAAATATC ATATTCTTTTTTT ATGTTCTAACGAATA TTTGTTTT GTTTTTCTTTTT ATCCTA TTGGATT GAGCAAAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCGCTATTTT AGTTGTA GGGTTAACTCAT GACTTTTA TTTTCCCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAACGGAGCTCATAATGAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTT GTTCTATGA ACGGATTCGTTTTCTTTTTT ATGAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATATTTCTT CTTCGCTTCACAATTT AGAATCAGATTTATTTTT CTTTTGTTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAAAA GGCTGGTCTTTTTTTTTT ATTTAATCCTATAACCC TAAAAAA CCAACGAGTCGCAC Ligusticum 58 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACCGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTAAAAATG TCTAT TATTCATTTGTATAG CTTGCTTTTTTAGCTAACTAAGCATATTAATATTT ATATTTTATATTTT TAAATATC ATATTCTTTTTTT ATGTTCTAACGAATA TTTGTTTT GTTTTTCTTTTT ATCCTA TTGGATT AAGCAAAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCATCGCTATTTT AGTTGTA GGGTTAACTCAT GACTTTTA TTTTCCCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAACGGAGCTCATAATGAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTTTTT GTTCTATGA ACGGATTCGTTTTCTTTTTT ATGAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAAATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATATTTTTT CTTCGCTTCACAATTT AGAATCAGATTTATTTTT CTTTTGTTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAAAA GGCTGGTCTTTTTTTTTT ATTTAATACTATAACCC TAAAAAA CCAACGAGTCGCAC Capnophyllum 285 GTTATAGTTGATGGTTGGTTCTGAATTGCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTTAAAATG TCTAT TATTCATTTGTATAT CTTGCTTTTTTAGCTAACTAAGCATATTAATATTT CTATTTTATATTTT AAAATTGATATTTTTAAATATC ATATTCTTTTTTT ATGTTCTAACGAATA TTTGTTTT GTTTTTCTTTTT ATCCTA TTGGATT GAGCAAAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCGCTATTTT AGTTGTA GGGTTAACTCAT GACTTC TTTTCCCA ATAG ATGAAGGAATTAGTTTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAACGGAGCTCATAATGCAATTTTTTATTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTT GTTCTATGA ACGGATTCGTTTTCTTTTTT ATGAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATCTTTGTT CTTCGCTTCACAACTT AGAATAATATTTATTTTT CTTTTGTTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAA GGCTGGTCTTTTTTTT ATTTAATCCTATAACCC TAAAAAA CCAACGAGTCGCAC Ferula 463 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTCAAAATG TCTAT TATTCATTTGTATAT CTTTCTTTTTTAGCTAACTAAGCATATTAATATTT CTATTTTATATTTT TAAATTGATATTTTTAAATATC ATATTCTTTTTTT ATGTTCTAACGAATA TTTGTTTT GTTTTTCTTTTT ATCCTA TTGGATT GAGCAAAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTAACTCTTTTCGTCGCTATTTT AGTTGTA GGGTTAACTCAT GACTTTTA TTTTCCCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAACGGAGCTCATAATGAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTT GTTCTATGA ACGGATTCGTTTTCTTTTTT ATGAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATATTTATT CTTCGCTTCACAATTT AGAATCAGATTTATTTTT CTTTTGTTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAAAAA GGCTGGTCTTTTTTTTTT ATTTAATCCTATAACCC TAAAAAA CCAACGAGTCGCAC Prangos 878 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTAAAAACG TCTAT TATTCGTTTGTATAT CTTGCTTTTTTAGCTAACTAAGCATATT ATT CTATTTTATATTTT TAAATATC ATATTCTTTTTTT ATGTTCTAACGAATA TTTGTTTT GTTTT TT ATCCTA TTGGATT GAGCAAAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCGCTATTTT AGTTGTA GGGTTAACTCAT GACTTTTA TTTTCTCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAACGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTT ATTTCTACAACGGAGCTCATAATTAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTT GTTCTATGA ACGGATTCGTTTTCTTTTTT ATGAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTT T CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATCTTTCTT CTTCGCTTCACAATTT AGAATCAGATTTATTTTT CTTTTGTTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAA GGCTGGTCTTTTCTTTTTTTTT ATTTAATCC TAAAAAA CCAACGAGTCGCAC Smyrniopsis 874 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTCAAAACG TCTAT TATTCGTTTGTATAT CTTGCTTTTTTAGCTAACTAAGTATATTAATATTT CTATTTTATATTTT TAAATATA ATATTCTTTTTTT ATGTTATAACGAATA TTTGTTTT GTTTG TT ATCCTA TTGGATT GAGCAGAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCGCTATTTT AGTTGTA GGGTTAACTCAT GACTTTTA TTTTCCCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGTATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAACGGAGCTCATAATGAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTT GTTCTATGA ACGGATTCGTTTTCTTTTTT ATGAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATCTTTCTT TTTCGCTTCACAATTT AGAATCAGATTTATTTTT CTTTTGTTT ATGCAAAAAATATTTCAGTTGCTACAGTGATATGAACAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAAAAA GGCTGGTCTTTTTTTTTT ATTTAATCCTATAACCCTAAAAAACCCTAAAAAA CCAACGAGTCGCAC Thyselium 47 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTCAAAATG TCTAT TATTCATTTGTATAT CTTTCTTTTTTAGCTAACTAAGCATATTAATATTT CTATTTTATATTTT TAAATTGATATTTTTAAATATC ATATTCTTTTTTT ATGTTCTAACGAATA TTTGTTTT GTTTTTCTTTTT ATCCTA TTGGATT GAGCAAAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTAACTCTTTTCGTCGCTATTTT AGTTGTA GGGTTAACTCAT GACTTTTA TTTTCCCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAACGGAGCTCATAATGAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTT GTTCTATGA ACGGATTCGTTTTCTTTTTT ATGAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATATTTATT CTTCGCTTCACAATTT AGAATCAGATTTATTTTT CTTTTGTTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAAAAA GGCTGGTCTTTTTTTTTT ATTTAATCCTATAACCC TAAAAAA CCAACGAGTCGCAC Conium 63 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTATAAAAATG TCTAT TATTCATTTGTATAT CTTGCTTTTTTAGCTAACTAAGCATATTAATATTT CTATTTTA TTTTTAATATC ATATTCTTTTTTT ATGTTCTAACGAATA TTTGTTTT GTTTTGCTTTTT ATCCTATTGGACTA TTGGATT GAGCAAAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCGCTATTTT AGTTGTA GGGTTAACTCAT GACTTTTA TTTTACCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTATACAACGGAGCTCATAATGAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTT GTTCTATGA ACGGATTCGTTTTCTTTTTT ATGAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATCTTTCTT CTTCGCTTCACAATTT AGAATCAGATTCATTTTT TTTTTGTTT ATGCAAAAAAGATTTCAGTTGCTACGGCGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAA GGCTGGTCTTTTTTTTT ATCCTATAACCC TAAAAAA CCAACGAGTCGCAC Azilia 25 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTAAAAATG TCTAT TATTCATTTGTATAT CTTGCTTTTTTAGCTAACTAAGCATATTAATATTT CTATTTTCTATTTT TAAATATC ATATTCTTTTTTT ATGTTCTAACGAATA TTTGTTTT GTTTTGCTTTTT ATCCTA TTGGATT GAGCAAAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCGCTATTTT AGTTGTA GGGTTAACTCAT GACTTTTA TTTTCCCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTATTTAATGGTTAGGTCTG ATTTCTACAACGGAGCTCATAATGAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTT GTTCTATGA ACGGATTCGTTTTCTTTTTT ATGAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATCTTTCTT CTTCGCTTCACAATTT AGAATCAGATTTATTTTT CTTTTGTTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAA GGCTGGTCTTTTTTTTTTT ATTTAATCCTATAACCC TAAAAAA CCAACGAGTCGCAC Pimpinella 19 GTTATAGTTGATTGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTCAAAATG TCTAT TATTCATTTGTATAT CTTGCTTTTTTAGCTAATTAAGCATATTAATATTT CTATTTTATGTTTT TAAATTGATATTTTTAAATATC ATATTCTTTTTTT ATGTTCTAACGAATA TTTGTTTT GTTTT TT ATCCTA TTGGATT GAGCAAAAA TTATCAACCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTTGCTATTTTAATTTTAGTTGTA CCCTTAACTCAT AACTTTTA TTTTCCCA ATAG ATCAACCAATTAGTCTCTCGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGCCTG ATTTCTACAACGGAGCTCATAATGAAATTTTTTCTTAAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTT GTTCTATGA ACGGATTCGTTTTCTTTTTT ATGAATCCATATTAA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATCGAATTTTATATCGTT GTTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATCTTTCTT CTTCGCTTCACAATTT GGAATCCTATTT TGTT CTTTTGTTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCAATAT AG CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAAAA GGCTGGTCTTTTTTTTTTTTTT ACCCTATAACTATGACCC TAAAAAA CCAACGAGTCGCAC Arafoe 888 GTTATAGTTGATGGTTGGTTCTTAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTCAAAATG TCTAT TATTCATTTGTATAT CTTGCTTTTTTAGCTAACTAAGCATATTAATATTT CTATTTTATATTTT TAAATTGATATTTTTAAATATC ATATTCTTTTTCTTTTTTT ATGTTCTAACGAATA TTTGTTTT GTTTTTCTTTTT ATCCTA TTGGATT GAGCAAAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCGCTATTTT AGTTGTA GGGTTAACTCAT GACTTTTA TTTTCCCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAACGGAGCTTATAATGAAATTTTTTCTTGAGCCGATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTT GTTCTATGA ACGGATTCATTTTCTTTTTT ATGAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTTTTGTTTT CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATATTTCTT CTTCGCTTCACAATTT AGAATCATATTT TTTTT CTTTTGTTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAAAAA GGCTGGTCTTTTTTTTTTT ATTTAATCCTATAACCC TTAACCTTAAAAAA CCAACGATTCGCAC Pyramidoptera 40 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTCAAAATG TTTAT TATTCATTTGTATAT CTTGCTTTTTTAGCTAACTGAGCATATTAATATTT CTATTTT TAAATATA ATATTATTTTTTT ATGTTCTAACGAATA TTTGTTTT GTTTT TT ATCCTA TTGGATT GAGCAAAAA TTATCAACCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCATCGCTATTTT AGTTGTA GGGTTAACTCAT GACTTTTC TTTTCCCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTAGTTAATGGTTAGGTCTG ATTTCTACAACGGAGCTCATAATGAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTT GTTCTATGA ACGGATTCGTTTTCTTTTTT ATGAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTT T CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATCTTTCTT CGCTTCACAACTT AGAATCAGATTTATTTTT CTTTTGTTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCAATAG AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAA GGCTGGTCTTTTTTTT ATTTAATCCTATAATCC TAAAAAA CCAACGAGTCGCAC Oedibasis 46 GTTATAGTTGATGGTTAGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTCAAAATG TTTAT TATTCATTTGTATAT CTTGCTTTTTTAGCTAACTGAGCATATTAATATTT CTATTTT TAAATTGATATTTTTAAATAGA ATATTATTTTTTT ATGTTCTAACGAATA TTTGTTTT GTTTTGCTTTTT ATCCTA TTGGATT GAGCAAAAA TTCTCAACCCAAGAA GAAAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCGCTATTTT AGTTGTA GGGTTAACTCAT GACTTTTA TTTTTCCA ATAA ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGAATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAACGGAGCTCAGAATGAAATTTTTTCTTGATCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTCATTTTTTT GTTCTATGA ACGGATTCGTTTTCTTTTTT ATGAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATTACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTGTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATCTTTCTT CTTCGCTTCACAACTT AGAATCAGATTTATTTTT CTTTTGTTT ATGCAAAAACGATTTCAGTTGCTACAGTGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAACA GGCTGGTCTTTTTTTTTTT ATTTAATCCTATAACCC TAAAAAA CCAACGAGTCGCAC Crithmum 831 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTCAAAATG TCTAT TATTCATTTGTATAT CTTGCTTTTTTAGCTAACTAAGCATATTAATATTT TTAAATATTAAATATA ATATTATTTTTTT ATGTTCTAACGGATA TTTGTTTT GTTTTGCTTTTT ATCCTA TTGGATT GAGCAAAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCGCTATTTT AGTTGTA GGGTTAACTCAT GACTTTTA TTTTCCCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAACGGAGCTCATAATGAAATTTTTTCTTTAGCCAATTTCCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTT GTTCTATGA ACGGATTCGTTTTCTTTTTT ATGAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATCTTTCTT CTTCGCTTCACAACTT AGAATCAGATTTATTTTT CTTTTGTTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAA GGCCGGTCTTTTTTTTTTTT ATTTAATCCTATAACCC TAAAAAA CCAACGAGTCGCAC Carum 430 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTCAAAATT TCTAT TATTCATTTGTATAT CTTGCTTTTTTAGCTAACTAAGCATATTAATATTT CTATTTT TCAATTGATATTTTTAAATATC ATATTCATATTCTTTTTTT ATGTTCTAACGAATA TTGGTTTT GTTTT TT ATCCTAT ATGGATT GAGCAAAAA TACTCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCACTATTTT AGTTGTA GGATTAACTCAT GACTTTTA TTTTCCCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCACCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAACGGAGCTCATAATGAAATTTTTTCTTGAGCCGATTTTCTTAGTCTTTGTTGGCTCGAAGCTCTTATTTTTTTTT GTTCTATGA ACGGATTCGTTTTCTTTTTT ATAAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCGTTTATCCAT ATCTTTCTT CTTCGCTTCACAACTT AGAATCATATTT TTT CTTTTGTTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAA GGCTGGTCTTTTTTTTT ATTTAATCCTATAACCC TAAAAAA CCAACGAGTCGCAC Aegopodium 882 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTCAAAATG TCTAT TATTCATTTGTATAT CTTGCTTTTTTAGCCAACTAAGCATATTAATATTT CTATTTT TAAATTGATATTTTTAAATATC CTATTCTTTTTTT ATGTTCTAACGAGTA TTTGTTTT GTTTTGCTTTTT ATCCTAT ATGGATT GAGCAAAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCGCTATTTT AGTTGTA GGGTTAACTCAT GACTTTTA TTTTCCCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAACGGAGCTCATAATGAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTT GTTCTATGA ACGGATTCGTTTTCTTTTTT ATGAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATCTTTCTT CTTCGCTTCACAACTT AGAATCAGATTTATTTTT CTTTTGTTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAG GGCTGGTCTTTTTTTTT ATTTAATCCTATAACCC TAAAAAA CCAACAATTCGCAC Fuernrohria 49 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTCAAAATT TCTAT TATTCATTTGTATAT CTTGCTTTTTTAGCTAACTAAGCATATTAATATTT CTATTTT TAAATTGATATTTTTAAATATC ATATTCTTTTTTT ATGTTCTAACGAATA TTGGTTTT GTTTT TT ATCCTAT ATGGATT GAGCAAAAA TAATAAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCACTATTTT AGTTGTA GGATTAACTCAT GACTTTTA TTTTCCCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAACGGAGCTCATAAGTCAATTTTTTCTTGAGCCGATTTTCTTAGTCTTTGTTGGCTCGAAGCTCTTATTTTTTTTT GTTCTATGA ACGGATTCGTTTTCTTTTTT ATAAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCGTTTATCCAT ATCTTTCTT CTTCGCTTCACAACTT AGAATCATATTT TTT CTTTTGTTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAA GGCTGGTCTTTTTTTT ATTTAATCCTATAACCC TAAAAAA CCAACGAGTCGCAC Trachyspermum 14 GTTATAGTTGAGGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTCAAAATG TCTAT TATTTATTTGTATAT CTTGCTTTTTTAGCTAACTAAGCATATTAATATTT CTATTTT GAAATTGATATTTTGAAATAGA ATATTCTTTTTTT ATGTTCTAACGAATA TTTGTTTT GTTTTGCTTTTT ATCCTA TTGGATT GAGCAAAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCGCTATTTT AGTTGTA GGGTTAACTCAT GACTTTTA TTTTCCCA ATAG ATGAAGGAATTGGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAACGGAGCTCATAATGAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTT GTTCTATGA ACGGATTCGTTTTCTTTTTT ATGAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCCTAAACCTTACATATT GGATGGAATTTGATATCGTT GTTTTT T CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATTTTTCTT CTTCGCTTCACAACTT AGAATCAGATTTATTTTT CTTTTGTTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAA GGCTGGTCTTTTTTTTTTTTTTTTTATTTAATCCTATAACCC TAAAAAA CCAACGAGTCGCAC Falcaria 889 GTTATAGTTGATGATTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTCAAAATG TCTAT TATTCATTTGTATAT CTTGCTTTTTTAGCTAACTAAGCATATTAATATTT CTATTTT AAAATAGAAAATATC ATATTCTTTTTTT ATGTTCTAACGAATA TTTGTTTT ATTTT TT ATCCTAT ATGGATT GAGCAAAAAAAAAATTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCGCTATTTT AGTTGTA TGGTTAATTCAT GACTTTTA TTTTCCCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAACGGAGCTCATAATGCAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTT TTCTATGA ACGGATTCGTTTTCTTTTTT ATGAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATCTTTCTT CTTCGCTTCACAATTT AGAATCAGATTTATTTTT CTTTTGTTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGCTTATTAGTTCTATAGTTAT TTGTTTATACAAAAA GGCTGGTCTTTTTTTTTTT ATTTAATCCTATAACCC TAAAAAA CCAACGAGTCGCAC Spermolepis 85 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTAAAAATG TCTAT TATTAATTTGTATAT CTTGCTTTTTTAGCTAACTAAGCATATTAATATTT CTATTTTATATTTT TAAATTGATATTTTTAAGTATC ATATTCTTTTTT ATGTTCTAACGAATA TTTGTTTT GTTTTTCTTTTT ATCCTA TTGGATT GAGCAAAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCGCTATTTT AGTTGTA GGGTTAACTCAT GACTTTTA TTTTCCCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTTTACAACGGAGCTCATAATGAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTT GTTCTATGA ACGGATTCGTTTTCTTTTTT ATGAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTTGTTTTTT CTACCCTTCTTTCACCCTTCCGTTTATCCAC ATATTTCTT CTTCGCTTCACAATTT AGAATCAGATTTATTTTT CTTTTGTTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAACTGATCAGTTGGTTATTACTTCTATAGTTAT TTGTTTATACAAAAAAAA GGCTGGTCTTTTTTTTT ATTTAATCCTATAACCC TAAAAAA CCAACGAGTCGCAC Seseli 54 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTAAAAATG TCTAT TATTCATTTGTATAT CTTGCTTTTTTAGCTAACTAAGCATATTAATATTT CTATTTTATATTTT TAAATTGATATTTTTAAAT T ATGTTCTAACGAATA TTTGTTTT GTTTTTCTTTTT ATCCTA TTGGATT GAGCAAAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCGCTATTTT AGTTGTA GGGTTAACTCAT GACTTTTA TTTTCCCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAACGGAGCTCATAATGAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTT GTTCTATGA ACGGATTCGTTTTCTTTTTT ATGAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATATTTCTT CTTCGCTTCACAATTT AGAATCAGATTTATTTTT CTTGTGTTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAAAA GGCTGGTCTTTTTTTTTTTTT AATTAAACCCTATAACCC TAAAAAA CCAACGAGTCGCAC Seseli 873 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTAAAAATG TCTAT TATTCATTTGTATAT CTTGCTTTTTTAGCTAACTAAGCATATTAATATTT CTATTTTATATTTT TAAATT ATGTTCTAACGAATA TTTGTTTT GTTTTTCTTTTT ATCCTA TTGGATT GAGCAAAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCGCTATTTT AGTTGTA GGGTTAACTCAT GACTTTTA TTTTCCCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAACGGAGCTCATAATGAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTT GTTCTATGA ACGGATTCGTTTTTTTTTTT ATGAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATATTTCTT CTTCGCTTCACAATTT AGAATCAGATTTATTTTT CTTGTGTTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAAATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAAAAA GGCTGGTCTTTTTTTTT ATTTAATCCTATAACCC TAAAAAA CCAACGAGTCGCAC Endressia 507 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTTAAAATG TCTAT TATTCATTTGTATAT CTTGCTTTTTTAGCTAACTAAGCATATGAATATTT CTATTTTATATTTT TAAATT ATGTTCTAACGAATA TTTGTTTT GTTTTTCTTTTT ATCCTA TTGGATT GAGCAAAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCGCTATTTT AGTTGTA GGGTTAACTCAT GACTTTTA TTTTCCCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCCG ATTTCTACAACGGAGCTCATAATGAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTT GTTCTATGA ACGGATTCGTTTTCTTTTTT ATGAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATATTTCTT CTTCGCTTCACAATTT AGAATCAGATTTATTTTT CTTTTATTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAAAAA GGCTGGTCTTTTTTTTTTTTT ATTTAATCCTATAACCC TAAAAAA CCAACGAGTCGCAC Karatovia 67 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTTAAAATT TCTAT TATTCATTTGTATAT CTTGCTTTTTTAGCTAACTAAGCATATTAATATTT CTATTTTATATTTT TAAATTGATATTTTCAAATT ATGTTCTAACGAATA TTTGTTTT GTTTTTCTTTTT ATCCTA TTGGATT GAGCAAAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCGCTATTTT AGTTGTA GGGTTAACTCAT GACTTTTA TTTTCCCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAACGGAGCTCATAATGAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTT GTTCTATGA ACGGATTCGTTTTCTTTTTT ATGAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTTGTTTTTT CTCCCCTTCTTTCACCCTCCCGTTTATCCAC ATATTTCTT CTTCGCTTCACAATTT AGAATCAGATTTATTTTT CTTTTGTTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAAAAA GGCTGGTCTTTTTTTTTT ATTTAATCCTATAACCC TAAAAAA CCAACGAGTCGCAC Phlojodicarpus 22 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTTAAAATG TCTAT TATTCATTTGTATAT CTTGCTTTTTTAGCTAACTAAGCATATTAATATTT CTATTTTATATTTT TAAATTGATATTTTTAAATATT ATGTTCTAACGAATA TTTGTTTT GTTTT TTTTT ATCCTA TTGAATT GAGCAAAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCGCTATTTT AGTTGTA GGGTTAACTCAT GACTTTTA TTTTCCCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAACGGAGCTCATAATGAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTT GTTCTATGA ACGGATTCGTTTTCTTTTTT ATGAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTTGTTTTTT CTCTCCTTCTTTCACCCTTCCGTTTATCCAC ATATTTCTT ATTCGCTTCACAATTT AGAATCAGATTTATTTTT CTTTTGTTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAAAAA GGCTGGTCTTTTTTTTTT ATTTAATCCTATAACCC TAAAAAA CCAACGAGTCGCAC Cortia 29 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTAAAAATG TCTAT TATTCATTTGTATAT CTTGCTTTTTTAGCTAACTAAGCATATTAATATTT CTATTTTATATTTT TAAATTGATATTTTTAAATATC ATATTCTTTTTTT ATGTTCTAACGAATA TTTGTTTT TCTTTTT ATCCTA TTGGATT GAGCAAAAA TTCTCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCGCTATTTT AGTTGTA GGGTTAACTCAT GACTTTTA TTTTCCCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCCATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAACGGAGCTCATAATGAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTT GTTCTATGA ACGGATTCGTTTTATTTTTT ATGAATCCATATTGATATTGATTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATATTTCTT CTTCGCTTCACAATTT AGAATCAGATTTATTTTT CTTTTGTTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATATGAAGTGATGAGTTGGTTATTAGTTCTATAATTAT TTGTTTATACAAAAAAAA GGCTGGTCTTTTTTTTT ATTTAATCCTATAACCC TAAAAAA CCAACGAGTCGCAC Coriandrum s n GTTATAGTTGATTGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTAAAAATG TCTAT TATTCATTTGTATAT CTTGCTTTTTTAGCTAACTAAGCATATTTATATTT TATATTTT TAAATTGATATTTTTAAATATC ATATTCTTTTTTT CTGTTCTAACGAATA TTTGTTTT GTTTTTCTTTTT ATCCTA TTGGATT GAGCAAAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGGCGCTATTTT AGTTGTA GGGTTAACTCAT GACTTTTA TTTTCCCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAACGGAGCTCATAATGAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTT GTTCTATGA ACGGATTCGTTTTATTTTT ATGAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTTATTTTTT AT GAGATGACTCGTAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATATTTCTT CTTCGCTTCACAATTT AGAATCAGATTTATTTTT CTTTTGTTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTTTATAGTTAT TTGTTTATACAAAAAAAAA GGCTGGTCTTTTTTTTTT ATTTAATCCTATAACCC TAAAAAA CCAACGAGTCGCAC Lithosciadium 32 GTTATAGTGGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTCAAAATG TCTAT TATTCATTTGTATAT CTTGCTTTTTTAGCTAACTAAGCATATTAATATTT CTATTTTCTATTTT TAAATTGATATTTTTAAATATC ATATTTGTTTTTT ATGTTCTAACGAATA TTTATTTT GTTTTTCTTTTT ATCCTA TTGGATT GAGCAAAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCGCTATTTT AGTTGTA GGGTTAACTCAT GACTTTTA TTTTCCCA ATCG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAACGGAGCTCATAATGAAATTTTTTCTTGAGCAAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTT GTTCTATGA ACGGATTCGTTTTCTTTTTT ATGAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATATTTCTT CTTCGCTTCACAATTT AGAATCAGATTTATTTTT CTTTTGTTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAAAA GGCTGGTCTTTTTTTTTT ATTTAATCCTATAACCC TAAAAAA CCAACGAGTCGCAC Aethusa 337 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTAAAAATG TCTAT TATTCATTTGTATAT CTTGCTTTTTTAGCTAACTAAGCATATTAATATTT ATATTTT TAAATTGATATTTTTAAATAGA ATATTATTTTTTT ATGTTCTAACGAATA TTTGTTTT GTTTTTATTTTT ATCCTA TTGGATT GAGCAAAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGACGCTATTTT CGTTGAA GGGTTAACTCAT GACTTTTA TTTTCCCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTATACAACGGAGCTCATAATGAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCTAAGCTCTTATTTTTTTT GTTCTATGA ACGGATTCGTTTTCTTTTTT ATGAATCCATATTGA TTGATGCTTT ATTACATTGATTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGAAATTTTATATCGTT GTTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATATTTCTT CTTCGCTTCACAATTT CGAATCAGATTTATTTTT CTTTTGTTT ATGAAAAAAAGATTTCAGTTGCTACAGTGATATGACTAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAAAAAAA GACCAGCCTTTTTTTT ATTTAATCCTATAACCC TAAAAAA CCAACGAGTCGCAC Exoacantha 204 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTGCAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTCAAAATG TCTAT TATTCATTTGTATAT CTTGCTTTTTTAGCTAACTAAGCATATTAATATTT CTATTTTCTATTTT TAAA TAGA ATATTCTTTTTTT ATGTTCTAACGAATA TTTGTTTT GTTTTTCTTTTT ATCCTA TTGGATT GAGCAAAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCGCTATTTT CGTTGTA GGGTTAACTCAT GACTTTTA TTTTCCCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTATACAATGGAGCTCATAATGAGATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCTAAGCTCTTATTTTTTTTT GTTTTATGA ACGGATTCGTTTTCTTTTTT ATGAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATATTTCTT CTTCGCTTCACAATTT CGAATCAGATTTATTTTT CTTTTGTTT ATGAAAAAAAGATTTCAGTTGCTACAGTGATATGACTAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGCTTATACAAAAAAAA GACCAGCCTTTTTTTT ATTTAATCCTATAACCC TAAAAAA CCAACGAGTCGCAC Tommasinia 40 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTAAAAATG TCTAT TATTCATTTGTATAT CTTGCTTTTTTAGCTAACTAAGCATATTAATATTT CTATTTTCTATTTT TAAATT ATGTTCTAACGAATA TTTGTTTT GTTTTTCTTTTT ATCCTA TTGGATT GAGCAAAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCGCTATTTT AGTTGTA GGGTTAACTCAT GACTTTTA TTTTCCCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAACGGAGCTCATAATGAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTT GTTCTATGA ACGGATTCGTTTTCTTTTTT ATGAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATATTTCTT CTTCGCTTCACAATTT AGAAATTTAGAATCAGATTTATTTTT CTTTTGTTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAAAAA GGCTGGTCTTTTTTTT ATTTAATCCTATAACCC TAAAAAA CCAACGAGTCGCAC Conioselinum 60 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTAAAAAAG TCTAT TATTCATTTGTATAT CTTGCTTTTTTAGCTAACTAAGCATATTAATATTT CTATTTTATATTTT TAAATTGATATTTTTAAATATC ATATTCTTTTTTT ATGTTCTAACGAATA TTTGTTTT GTTTTTCTTTTT ATCCTA TTGGATT GAGCAAAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCGCTATTTT AGTTGTA GGGTTAACTCAT GACTTTTA TTTTCCCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAACGGAGCTCATAATGAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTT GTTCTATGA ACGGATTCGTTTTCTTTTTT ATGAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCTGTTTATCCAC ATATTTCTT CTTCGCTTCACAATTT AGAATCAGATTTATTTTT CTTTTATTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAAAAAGGAAA GGCTGGTCTTTTTTTTTTTTTTT AATTTAATCCTATAACCC TAAAAAA CCAACGAGTCGCAC Opopanax 38 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTCAAAACG TCTAT TATTCGTTTGTATAT CTTGCTTTTTTAGCTAACTAAGCATATTAATATTT CTATTTTATATTTT TAAATATA ATATTCTTTTTTT ATGTTCTAACGAATA TTTGTTTT GTTTT TT ATCCTA TTGGATT GAGCAAAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCGCTATTTT AGTTGTA GGGTTAACTCAT GACTTTTA TTTTCCCA ATAG ATGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGTATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAACGGAGCTCATAATGAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTT GTTCTATGA ACGGATTCGTTTTCTTTTTT ATGAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATCTTTCTT TTTCGCTTCACAATTT AGAATCAGATTTATTTTT CTTTTGTTT ATGCAAAAAATATTTCAGTTGCTACAGTGATATGAACAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAAAAA GGCTGGTCTTTTTTTT ATTTAATCCTATAACCC TAAAAAA CCAACGAGTCGCAC Peucedanum 44 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTAAAAATG TCTAT TATTCATTTGTATAT CTTGCTTTTTTAGCTAACTAAGCATATTAATATTT TAATTTTTTAAATATT GTATTCTTTTTTT ATGTTATAACGAATA TTTATTTT GTTTTGCTTTTT ATCCTA TTGGATT GAGCAAAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCGCTATTTT AGTTGGA GGGTTAACTCAT TACTTTTC TTTTCCCA ATAT ATGAAGGAATAAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCATAGGTTACATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTT ATTTATACAATGGAACCCGTAATGAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCTAAGCTCTTATTTTTTTTT GTTCTATGA ACGGATTCGTTTTCTTTTTT ATGAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGATTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATATTTCTT CTTCGCTTCACAATTT CGAATCAGATTTATTTTT CTTTTGTTT ATGAAAAAAAGATTTCAGTTGCTACAGTGATATGACTAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAAAAAA GACCAGCCTTTTTTTTT ATTTAATCCTATAACCC TAAAAAA CAAACGAGTCGCAC Peucedanum 359 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTCAAAATG TCTAT TATTCATTTGTATAT CTTGCTTTTTTAGCTAACTAAGCATATTAATATTT CTATTTTATATTTT TAAATTGATATTTTTAAATATC ATATTATTTTTTT ATGTTCTAACGAATA TTTGTTTT GTTTTTCTTTTT ATCCTA TTGGATT GAGCAAAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCGCTATTTT AGTTGTA GGGTTAACTCAT GACTTTTA TTTTCCCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAACGGAGCTCATAATGAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTT GTTCTATGA ACGGATTCGTTTTCTTTTTT ATGAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATATTTCTT CTTCGCTTCACAATTT AGAATCAGATTTATTTTT CTTTTGTTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAAAAA GGCTGGTCTTTTTTTTT ATTTAATCCTATAACCC TAAAAAA CCAACGAGTCGCAC Peucedanum 886 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTCAAAATG TCTAT TATTCATTTGTATAT CTTGCTTTTTTAGCTAACTAAGCATATTAATATTT CTATTTTATATTTT TAAATTGATATTTTTAAATATC ATATTCTTTTTTT ATGTTCTAACGAATA TTTGTTTT GTTTTTCTTTTT ATCCTA TTGGATT GAGCAAAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCGCTATTTT AGTTGTA GGGTTAACTCAT GACTTTTA TTTTCCCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAACGGAGCTCATAATGAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTT GTTCTATGA ACGGATTCGTTTTCTTTTTT ATGAATCCAGATTGATATTGATTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATATTTCTT CTTCGCTTCACAATTT AGAATCAGATTTATTTTT CTTTTGTTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATATGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAAAAG GGCTGGTCTTTTTTTTT ATTTAATCCTATAACCC TAAAAAA CCAACGAGTCGCAC Chymsydia 872 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTCAAAATG TCTAT TATTCATTTGTATAT CTTGCTTTTTTAGCTAACTAAGCATATTAATATTT CTATTTTATATTTT TAAATTTATATTTTTAAATATC ATATTCATATTTTTTTTTT ATGTTCTAACGAATA TTTGTTTT GTTTT TT ATCCTA TTGGATT GAGCAAAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCGCTATTTT AGTTGTA GGGTTAACTCAT GACTTTTA TTTTCCCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAACGGAGCTCATAATGAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTT GTTCTATGA ACGGATTCGTTTTCTTTTTT ATGAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATATTTCTT CTTCGCTTCACAATTT AGAATCAGATTCATTTTT CTTTTGTTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAAAAAA GGCTGGTCTTTTTTTTT ATTTAATCCTATAACCC TAAAAAA CCAACGAGTCGCAC Imperatoria 887 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTCAAAATG TCTAT TATTCATTTGTATAT CTTGCTTTTTTAGCTAACTAAGCATATTAATATTT CTATTTTATATTTT TAAATTGATATTTTTAAATATC ATATTCTTTTTTT ATGTTCTAACGAATA TTTGTTTT GTTTTTCTTTTT ATCCTA TTGGATT GAGCAAAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCGCTATTTT AGTTGTA GGGTTAACTCAT GACTTTTA TTTTCCCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAACGGAGCTCATAATGAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTTT GTTCTATGA ACGGATTCGTTTTCTTTTTT ATGAATCCATATTGATATTGATTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATAGAATTTTATATCGTT GTTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATATTTCTT CTTCGCTTCACAATTT AGAATCAGATTTATTTTT CTTTTGTTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAAAAAG GGCTGGTCTTTTTTTTT ATTTAATCCTATAACCC TAAAAAAACCAACGAGTCGCAC Sphaenolobium 68 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTAAAAAAG TATAT TATTCATTTGTATAT CTTGCTTTTTTAACTAACTAAGCATATTAATATTT CTATTTTATATTTT TAAATTGATATTTTTAAATATC ATATTCTTTTTTT ATGTTCTAACGAATA TTTGTTTT GTTTTTCTTTTT ATCCTA TTGGATT GAGCAAAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCGCTATTTT AGTTGTA GGGTTAACTCAT GACTTTTA TTTTCCCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAACGGAGCTCATAATGAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTT GTTCTATGA ACGGATTCATTTTCTTTTTT ATGAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTTATTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATATTTCTT CTTCGCTTCACAATTT AGAATCAGATTTATTTTT CTTTTATTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAAAAAA GGCTGGTCTTTTTTTT TTTTTACCCTATAACCC TAAAAAAACCAACGAGTCGCAC Apium 258 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA GAAAATTTTCAAAATG TCTAT TTTTCATTTGTATAT CTTGCTTTTTTAGCTAACTAAGCATCTTAATATTT CTATTTT TAAATTTCTATTTTTAAATATC ATATTCTTTTTTT ATGTTCTAACGAATA TTCGTTTT GTTTTGCTTTTT ATCCTA TTGGATT GAGCAAAAA TTATCAATCCAAGAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCACTATTTT AGTTGTA GGGTTAACTCAT GACTTTTA TTTTCCCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAACGGAGCTCATAATGAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTT GTTCTATGA ATAGATTCGTTTTTTTTTTTT AAGAATCCATATTGC TTGAAGCTTT ATTACATTGCTTTTTTATTTTTT AA GAAAAGACTCCTAAACCTTACATATT GGAAGGAATTTTATATCGTT GTTTTT T CCCCCCTTCTTTCACCCTTCCGTTTATCCAC ATCTTTCTT CTTCCCTTCACAACTT AGAATCCGAATTATTTTT CTTTTGTTT ATGCAAAAAAAATTTCAGTTGCTACAGTGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAAAA GGCTGGTCTTTTTT TTTTAATCCTATAACCC TAAAAAA CCAACGAGTCACAC Anethum 157 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTCAAAATG TCTAT TATTCATTTGTATAT CTTGCTTTTTTAGCTAACTAAGCATATTAATTATT AATTCTATTTT TA TTTAAATATC ATATTCTTTTTT ATGGGCTAACGAATA TTCGGTTT GGTTTGCTTTTT ATCCTA TTGGATT GAGCAAAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCACTATTTT AGTTGTA GGGTTAACTCAT GACTTTGA TTTTCCCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTATACAACGGAGCTCATAATGAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTT GTTCTATGA ACGGATTCGTTTTTTTTTTTTTTATGAATCCATATTGC TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTT T CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATCTTTCTT CTTCGCTTCACAACTT AAAATCAGATTTATTTTT CTTTTGTTT ATGCAAAAAAAATTTCAGTTGCTACAATGATTTGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAAATAATGTGAATTGATGAGTTGGTTATTATTTCTATAGTTAT TTGTTTAAACAAAAA GGGCGGTCTTTTTTTT TTTTAATCCTATAACCC TAAAAAA CCAACGAGTCACAC Foeniculum 187 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA GAAAATTTTCAAAATG TCTAT TATTCATTTGTATAT CTTGCTTTTTTAGCTAACTAAGCATATTAATTATT AATTCTATTTT TA TTTAAATATC ATATTCTTTTTT ATGTTCTAACGAATA TTCGTTTT GTTTTGCTTTTT ATCCTA TTGGATT GAGCAAAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCACTATTTT AGTTGTA GGGTTAACTCAT GACTTTGA TTTTCCCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTATACAACGGAGCTCATAATGAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTT GTTCTATGA ACGGATTCGTTTTTTTTTTTTTTATGAATCCATATTGC TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATGTT GGATGGAATTTTATATCGTT GTTTTT T CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATCTTTCTT CTTCGCTTCACAACTT AAAATCAAATTTATTTTT CTTTTGTTT ATGCAAAAAAAATTTCAGTTGCTACAATGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAAATAATGTGAATTGATAATTTGGTTATTATTCCTATAGTTAT TTGTTTAAACAAAAA GGCGGGTCTTTTTTTT TTTTAATCCTATAACCC TAAAAAA CCAACGAGTCACAC Ridolfia 822 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA GAAAATTTTCAAAATG TCTAT TATTCATTTGTATAT CTTGCTTTTTTAGCTAACTAAGCATATTAATTATT AATTCTATTTT TAAATATC ATATTCTTTTTT ATGTTCTAACGAATA TTCGTTTT GTTTTGCTTTTT ATCCTA TTGGATT GAGCAAAAA TTATCAATCCAAGAA GAT AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCACTATTTT AGTTGTA GGGTTAACTCAT GACTTTTA TTTTCCCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTATACAACGGAGCTCATAATGAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTT GTTCTATGA ACGGATTCGTTTTTTTTTTTTTTATGAATCCATATTGC TTGAAGCTTT ATTACATTGCTTTTTT AT GAAATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTT T CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATCTTTCTT CTTCGCTTCACAACTT AAAATCAAATTTATTTTT CTTTTGTTT ATGCAAAAAAAATTTCAGTTGCTACAATGATATGACCAATAT AT CATATCTTGACTGGTTTTTT GGATCCAAATAATGTGAATTGATAATTTGGTTATTATTCCTATAGTTAT TTGTTTAAACAAAAA GGCGGGTCTTTTTTTT TTTTAATCCTATAACCC TAAAAAA CCAACGAGTCACAC Conioselinum 501 GTTATAGTTGGAGGTTGGTTCTGGATTCCATCTCTACTACAGAACTGGACATGAGAGATTCTTCTCATCCAGCTCCTCGCGGATAA TAAAATTTTCAAAATG TCTAT TATTCATTTGTATAT CTTGCTTTTTTAGCTAACTAAGCATATTAATTTAATATTT ATTTTTTATATTTT AAAATTTATATTTTTAAATATC GTATTATTTTTTT ATGTTATAACGAATA TTTATTTT GTTTTGCTTTTT ATCCTA TTGAATT GAGCAAAAA TTATCAATCCAAGAA GAA AAAGTTTTCA CGGGCGAATATTGACTCTTTTCGTCGCTATTTT AGTTGTA GGGTTAACTCAT GACTTTTC TTTTACCA ATAG ATGAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAATGGGACTCTAAATGAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCAAAGCTCTTATTTTTTTT GTTCTATGA ACGGATTCGTTTTCTTTTTT TTGAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GTTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCGTTTATCCAC ATCTTTCTT CTTCGCTTCACAACTT AGAATCAGATTTATTTTT CTTTTGTTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCGATAT AT CATATCTTGACTGGTTTTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTATAGTTAT TTGTTTATACAAAAA GGCTGGTCTTTTTTTT CTTTAATCCTA ACCC TAAAAAA CCAACGAGTCGCAC Oenanthe 273 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTAAAAATG TCTAT TATTCCTTTGTATAT CTTGCTTTTTTAACTAACTAAACATATTAATATTT T TAAATTTTTATTTTTAAATATC GTATTT ATGTTATAATGAATA TTTATTTT GTTTTGCTTTTT ATCCTA TTGGATT GACCAAAAA TTATCAATCCAATAA AATAAAAAAGTTTTCA CGGGCGAATATTTACTCTTTTC TTTTCCCA ATAG ATTAGTTTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAAA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAATGGAGCTCATGATAAAATTTTTTCTTGAGTCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTT GTTCTATGA ACGGATTCGTTTTCTTTTTT ATAAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GGTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCATTTATCCGCTTATCCGCATCTTTCTT CTTTGCTTCACACCTT AGAATCAGATTTATTTTT TTTGTTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCGATAT AT CATATCTTGACTGGTTCTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAATTAT TTGTTTATACAAATACAAAA GGGTTGGTCTTTTTTTTTT CTTTAATCCTA ACCC TAAAAAA CCAACGAGTCGCAC Cicuta 75 GTTATAGTTGAGGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTAAAAATG TCTAT TATTCCTTTGTATAT CTTGCTTTTTTAACTAACTAAACATATTAATATTT CTATTTTATTTTTT TAAATTTTT ATGTTATAATGAATA TTTATTTT GTTTTGCTTTTT ATCCTA TTGGATT GACCAAAAA TTATCAATACAAGAA AATAAAAAAGTTTTCA CGGGCGAATATTTACTCTTTTC TTTTCCCA ATAG ATTAGTTTATGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAATGGAGCTCATGATAAAATTTTTTCTTGAGTCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTT GTTCTATGA ACGGATTCGTTTTCTTTTTT ATAAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GGTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCATTTATCCGC ATCTTTCTT CTTTGCTTCACACCTT AGAATCAGATTTATTTTT CTTTTGTTT ATGCAAAAAAGATTTCAGTTGCTACAGCGATATGACCGATAT AT CATATCTTGACTGGTTCTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAATACAAA GGGGCTGGTCTTTTTTTT CTTTAATCCTA ACCC TAAAAAA CCAACGAGTCGCAC Cryptotaenia 574 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGTGAATAA TAAAATTTTAAAAATG TCTAT TATTCATTTGTATAT CTTGCTTTTTTAGCTAACTAAACATATTAATATTT CTATTTTATATTTT TAAATATC GTATGAATATTGTATTT ATGTTATAATGAATA TTTATTTT GTTTTGCTTTTT ATCCTA TTGGATT GACCAAAAA TTATCAATCCAAGAA AATAAAAAAGTTTTCA CGGGCGAATATTTACTCTT TTTTCCCA ATAG ATTAGTTTATGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGATTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAATGGAGCTCATGATGAAATTTTTTCTTGAGCCAATTTTATTAGTCTTTATTGGCTCGAAGCTCTTCTTTTTTTT GTTCTATGA ACAGATTCCTTTTCTTTTTT ATAAATTCATATTTA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GGTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCATTTATCCGC ATCTTTCTT CTTTGCTTCACACTTT AGAATCAGATTTATTTTT CTTTTGTTT ATGATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACGGATAT AT CATATCTTGACTGGTTCTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAATACAA AAAGGGGCTGGTCTTTTTTTTTT CTTTAATCCTA ACCC TAAAAAA CCAACGAGTCGCAC Sium 97 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGTGAATAA TAAAATTTTAAAAATG TCTAT TATTCATTTGTATAT CTTGCTTTTTTAGCTAACTAAAAATATTTATATTT TCTATTTT TAAATTTATATTTTTAAATATC GTATGAATATTATATTT ATGTTATAATTAATA TTTATTTT GTTTTGCTTTTT ATCCTA TTGGATT GACCAAAAA TTATCAATCCAAGAA AATAAAAAAGTTTTCA CGGGCGAATATTTACTCTT TTTTCCCA ATAG ATTAGTTTCTGGTTTGTTTCGCCATCCTGATCAATGAGTCTGTTTTCAATATA TTTGGATTCACAGATTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAATGGAGCTCATGATGAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTT GTTCTATGA ACAGATTCGTTTTATTTTTT ATAAATTCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATCTTATATCGTT GGTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCATTTATCCGC ATCTTTCTT CTTTGCTTCACACTTT AGAATCAGATTTATTTTT CTTTTGTTT ATGCAAAAAAGATTTCAGTTGCTACAGTGATATGACCGATAG AT CATATCTTGACTGGTTCTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAATACAAAA GGGCTGGTCTTTTTTTTTTTT CTTTAATCCTA ACCC TAAAAAA CCAACGAGTCGCAC Oxypolis 503 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGTGAATAA TAAAATTTTAAAAATG TCTAT TATTCATTTGTATAT CTTGCTTTTTTAGCTAACTTAAAATATTTATATTT TAAAATTGATATATTTA AATATTAAATATC TTATGAATATTATATTT ATGTTATAATGAATA TTTATTAT GTTTTGCTTTTT ATCCTA TTGGATT GACCAAAAA TTATCAATCCAAGAA AATAAAAAAGTTTTCA CGGGCGAATATTTACTTTT TTTTCCCA ATAG ATTAGTTTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGATTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTT ATTTCTACAATGGAGCTCATGATGAAATTTTTTCTCGAGCCAATTTTCTTAGTCTTTATTGGCTTGAAGCTCTTATTTTTTTTTT GTTCTATGA ACAGATTCGTTTTCTTTTTT ATAAATTCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTG GGTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCATTTATCCGC ATCTTTCTT CTTTGCTTCACACTTT AGAATCAAATTTATTTTT CTTTTGTTT ATGCAAAAAAGATTTCAGTTGCTACAGTAATATGACCAATAT AT CATATCTTGACTGGTTCTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAATACAAAA GGGCTGGTCTTTTTTTTT CTTTAATCCTA ACCC TAAAAAA CCAACGAGTCGCAC Perideridia 778 GTTATAGTTGAGGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTTAAAAATG TCTATGTCTATATATTCATTTGTATAT CTTGCTTTTTTAGCTAACTAAACATATTAATATTT CTATTTTATATTTT TAAATATC GTA TTTATTTT GTTTTGCTTTTT ATCCTA TTGGATT GACCAAAAA TTATCAATCCAAGAA AATAAAAAAGTTTTCA CGGGCGAATATTTACTCTTTTC TTTTACCA ATAG ATTAGTATAGATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTAAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTT ATTTCTACAATGGAGCTCATGATTAAATTTTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTTT GTTCTATGA ACGGATTCGTTTTATTTTTT ATGAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT GGTTTTGTTTTTT CTCCCCTTCTTTCACCCTTCCATTTATCCGC ATCTTTCTT CTTTGCTTCACACCTT AGAATAAGATTTATTTTT CTTTTGTTT ATGCAAAAAACATTTCAGTTGCTACAGTGATATGACCGATAT AT CATATCTTGACTGGTTCTTT GGATCCAGATAATGTGAAGTGATGAGTTGGTTATTAGTTCTATAGTTAT TTGTTTATACAAATACAATTTATACAAATACAAAA GGGCTGGTCTTTTTTTTTTTT CTTTAATCCTA ACCC TAAAAAA CCAACGAGTCGCAC Aciphylla 578 GTTATAGTTGATGGTTGGTTCTGAATTCCATCTCTACTACAGAACTGGACATGAGAGTTTCTTCTCATCCAGCTCCTCGCGAATAA TAAAATTTACAAAATG TCTAT TATTCATTTGTATAT CTTGCTTTTTTAACTAACAAAGCATATTAATTTTT ATATTTTTCAATATC GTATTCTTTTTTT ATGTTATAACGAATA TTTTTTTTTTTGTTTTGATTTTT ATCCTA TTGGATT GATCAAAAA TTATCAATCCAAAAA AAT AAAATTTTCA CGGGCAAATATTTACTCTTTTCGTCTTTATTTA AATTGTG GGGTTAACTCAT GACTTTTA TTTTCCCA ATAA ATAAAGGAATTAGTCTCTGGTTTGTTTCGCCATCCCGATCAATGAGTCTGTTTTCAATAGA TTTGGATTCACAGGTTCCATCGTTCCCATCGCTTCTTACTTAATGGTTAGGTCTG ATTTCTACAATGGAGCTCATAATGAAATTGTTTCTTGAGCCAATTTTCTTAGTCTTTATTGGCTCGAAGCTCTTATTTTTTT TTTCTATGA ACGGATTCGTTTTCTTTTTT ATGAATCCATATTGA TTGATGCTTT ATTACATTGCTTTTTT AT GAGATGACTCATAAACCTTACATATT GGATGGAATTTTATATCGTT

    Original URL path: http://ajbsupp.botany.org/v87/downie.txt (2016-02-14)
    Open archived version from archive


  • Alibertia pilosa CAGCGCCAAGGAAAACC1A1TACCGTAA 0 TGG ATCGCTCGGCCCCC1AGACCGTCCCGTTCGCGGAGCGCG GGAGGGGA CGCCGCGGCGT0 CC Alibertia rigida CAGCGCCAAGGAAAATT1A1TACCGTAA 0 TGG ATCGCSCGSSCCCC0 GACCGTCCCGTTCGCGGAGCGCG GGAGGGGAWTGCCGCGGCGT1GTCC Alibertia sessilis CAGCGCCAAGGAAAACT1A1TACCGTAA 0 TGG ATCGCTCGGCCCCC0 GACCGTCCCGTTCGCGGAGCGCG GGAGGGGA CGCCGCGGCGT1GTCC Alibertia steinbachii CAGCGCCAAGGAAAACC1A1TACCGTAA 0 TGG ATCGCTCGGCCCCC0 GACCGTCCCGTTCGCGGAGCGCG GGAGGGGA CGCCGCGGCGT0 CC Alibertia aff stricta CAGCGCCAAGGAAAACC1A1TACCGTAA 0 TGG ATCGCACGGCCCCC0 GACCGTCCCGTTCGCGGAGCGCG GGAGGGGA CGCCGCGGCGT1GTCC Alibertia subaurea CAGCGCCAAGGAAAACT1A1TACCGTAA 0 TGG ATCGCTCGGCCCCC0 GACCGTCCCGTTCGCGGAGCGCG GGAGGGGA CGCCGCGGCGT1GTCC Alibertia tutumilla CAGCGCCAAGGAAAACT0 1TACCGCAA 0 GGG ATCGCCCGGCCCCC0 GATCGCCCCGTTCGCGGAGCGCG GGAGGGGA TGCCGCGGCGT0 CC Alibertia utleyorum CAGCGCCAAGGAAAACT0 1TATCGTAA 0 GGG ATCGCCCGGCCCCC0 GATCGCCCCGTTCGCGGAGCGCG GGAGGGGA TGNNNNNNCGT0 CC Amaioua corymbosa CAGCGCCAAGGAAAACT1C0 AA 1ATGG ATCGCCCGGCCCCC0 GAATGCCCCGTCCGCGGAGCGCA GGAGGGGA TGCCGCGGCGC0 CT Amaioua guianensis CAGCGCCAAGGAAAACT1C0 AA 1TTGG ATCGCCCGGCCCCC0 GAACGCCCCGTYCGCGGAGCGCG GGAGGGGA TGCCGCGGCGC0 CT Borojoa panamensis CAGCGCCAAGGAAAACT0 1TACCGTAA 0 GGG ATCGCCCGGCCCCC0 GATCGCCCCGTTCGCGGAGCGCG GGAGGGGA TGCCGCGGCGT0 CC Borojoa patinoi CAGCGCCAAGGAAAACT0 1TACCGTAA 0 GGG AACGCCCGGCCCCC0 GATCGCCCCGTTCGCGGAGCGCG GGAGGGGA CGCCGCGGCGC0 CC Borojoa sp CAGCGCCAAGGAAAACT0 1TACCGCAA 0 GGG ATCGCCCGGCCCCC0 GATCGCCCCGTTCGCGGAGCGCG GGAGGGGA TGCCGCGGCGT0 CC Duroia aquatica CAGCGCCAAGGAAAACT1C0 AA 1AGAG ATCGCCCGGCCCCC0 GAACGCCCCGTCCGCGGAGCGCG GGAGGGGA TGCCGCGGCGT0 CT Duroia eriopila CAGCGCCAAGGAAAACT1C0 AA 1AGAG ATCGCCCGGCCCCC0 GAATGCCCCGTCCGCGGAGCGCA GGAGGGGA TGCCGCGGCGT0 CC Duroia hirsuta CAGCGCCAAGGAAAACT1C0 AA 1AGGG ATCGCCCGGCACCC0 GAATGCCCCGTCCGCGGAGCGCA GGAGGGGA CGCCGCGGCGT0 CT Duroia micrantha CAGCGCCAAGGAAAACT1C0 AA 1AGTG ATCGCCCGGCCCCC0 GAACGCCCCGTCTGCGGAGCGCG GGAGGGGA AGCCGCGGCGT0 CC Genipa curviflora CAGCGCCAAGGAAAAC ataaAA 1AGGG ATCGCCCGGCACCC1CGACCGCCCCSTCCGCGGAGCGCG GGAGGGAA TGCCGCGGCGT0 CT Genipa aff williamsii CAGCGCCAAGGAAAAC ataaAA 1AGGG ATCGCCCGGCCCCC1CGACCGCCCCGTCCGCGGAGCGCG GGAGGGAA TGCCGCGGCGT0 CT Genipa concinna CAGCGCCAAGGAACACT1C GATCG AA 0 GGG ATCGCCCGGCCCCC0 GACCGCCCCGTCCGCGGGGCGCG GGAGGGGA CGCCGCGGCGC0 CC Ibetralia CAGCGCACAGGAAAACT1C0 AA 1AGTG ACCGCCCGGCCCCC0 GACCGCCCCGTCCGCGGAGCACGCGGAGGGGA TGCCGCGGCGT0 CC Kutchubaea semiserica CAGCGCACAGGAAAACT1C0 AA 1AGTG ATCGCCCGGCCCCC0 GACCGCCCCGTCCGCGGAGCGCG GGAGGGGA TGCCGCGGCGT0 CC Randia tessmanii 0 Species nova CMGCGCCAAGGAAAACT1A ctcactCA RAGGAATCGCYCGGCCCCC0 GACCGCCCCGTSCGCGGAGCGCG GGAGGVGA GCCGCGGCGT0 CT Stachyarrhena sp CAGCGCCAAGGAAAACT1G0 AA 1AGGG AACGCCCGGCCCCC0 GACCGCCCCGTCCGCGGAGCGCG GGAGGGGA CGCCGAGGCGT0 CC Rosenberg densiflorum AAGCGCCAAGGAATACT1C0 AAA1AGGG ATCGCCCGGCACCC1CGACCGCCCCGTTCGCGGAVCVCG GGAGGGGA CGCCGCGGCGT0 CT Randia aristeguitae AAGCGCCAAGGAAAACT1C0 AA 1AAGG AACGCCCGGCCCCC0 GACCGCCCCGTCCGCGGAGCGCG GGAGGGGA TGCCGCGGCGT0 CT 310 320 330 340 350 360 370 380 390 400 ITS2 I Alibertia acuminata g tn t 1gAA0 CCGATCGCGTCGCCAGCCCccct ccc GCGGGG1G CGGCGGAGAGTGGCCTCCCGTGCCC01CGTGCGGGCGCGGT Alibertia amplexicaulis g tc gt 1gAA0 CCGATCGCGTCGCCACCCCcc taccc GCGGGG1G CGGCGGAGAGTGGCCTCCCGTGCCC00 GTCGGCGCGGC Alibertia bertierifolia g tc gc 1gAA0 CCAATCGCGTCGCCACCCCc tccccgtcgggGCGGGG1G CGGCGGAGAGTGGCCCCCCGTGCCC00 GTCGGCGCGGC Alibertia concolor n nn nn nNN0 NNNATCGCGTCGCCGCCCCccataccc GCGGGG1G CGGCGGAGAGTGGCCTCCCGTGCCC00 GTCGGCGCGGC Alibertia curviflora g ta n 1gAA0 CCGATSGCGTCGCCAGCCCccct ccc GCGGGG1G CGGCGGAGAGTGGCCTCCCGTGCCC01CGTGCGGGCGCGGT Alibertia edulis g tc t 1gAA0 CCGATCGCGTCGCCAGCCCccct ccc GCGGGG1G CGGCGGAGAGTGGCCTCCCGTGCCC01CGTGCGGGCGCGGT Alibertia elliptica g tc gt 1gAA0 CCGATCGCGTCGCCACCCCcccataccc GCGGGG1G CGGCGGAGAGTGGCCTCCCGTGCCC00 GTCGGCGCGGC Alibertia garapatica g tc gt 1gAA0 CCGATCGCGTCGCCGCCCCccgcaccc GCGGGG1G CGGCGGAGAGTGGCCTCCCGTGCCC00 GTCGGCGCGGC Alibertia hassleriana g tc gt 1gAA0 CCGATCGCGTCGCCACCCCccataccc GCGGGG1G CGGCGGAGAGTGGCCTCCCGTGCCC00 GTCGGCGCGGC Alibertia hispida g t gt 0 AA0 CCGATCGCGTCGCCACCCCccct ccctc GCGGGC3GGATGGCGGAGAGTGGCCTCCCGTGCTC11CTCGCGGGCGCGGT Alibertia latifolia g tc gt 1gAA0 CCGATCGCGTCGCCAGCCCccct ccc GCGGGG1G CGGCGGAGAGTGGCCTCCCGTGCCC01CGTGCGGGCGCGGT Alibertia macrophylla g tc gt 1gAA0 CCGATCGCGTCGCCACCCCcc tacccc GCGGGG1G TGGCGGAGAGTGGCCTCCCGTGCCT00 GTCGGCGCGGC Alibertia myrciifolia g tc gt 1gAA0 CCGATCGCGTCGCCACCCCccc accct ACGGGG1G CGGCGGAGAGTGGCCTCCCGTGCCC00 GTCGGCGCGGC Alibertia pilosa g tc gt 1gAA0 CCGATCGCGTCGCCGCCCCccgcacca GCGGGG1G CGGCGGAGAGTGGCCTCCCGTGCCC00 GTCGGCGCGGC Alibertia rigida g tc gt 1gAA0 CCAATCGCGTCGCCACCCCcc taccc GCGGGG1G CGGCGGAGAGTGGCCTCCCGTGCCC00 GTCGGCGCGGC Alibertia sessilis g tc gt 1gAA0 CCAATCGCGTCGCCACCCCcactaccc GCGGGG1G CGGCGGAGAGTGGCCTCCCGTGCCC00 GTCGGCGCGGC Alibertia steinbachii g tc gt 1gAA0 CCGATCGCGTCGCCGCCCCccgcaccc GCGGGG1G CGGCGGAGAGTGGCCTCCCGTGCCC00 GTCGGCGCGGC Alibertia aff stricta g tc gt 1gAA0 CCGATCGCGTCGCCTCCCCccctacac GCGGGG1G CGGCGGAGAGTGGCCTCCCGTGCCC00 GTCGGCGCGGT Alibertia subaurea g tc gt 1gAA0 CCGATCGCGTCGCCACCTTcc taccc ACGGGG1G CGGCGGAGAGTGGCCTCCCGTGCCC00 GTCGGCGCGGC Alibertia tutumilla g tc gt 1gAA0 CCGATCGCGTCGCCAGCCCccct ccc GCGGGG1G CGGCGGAGAGTGGCCTCCCGTGCCC01CGTGCGGGCGCGGT Alibertia utleyorum g nn nn nNN NNNATCGCGTCGCCAGCCCccct ccc GCGGGG1G CGGCGGAGAGTGGCCTCCCGTGCCC01CGTGCGGGCGCGGT Amaioua corymbosa g tc gt 0 AA0 CCAATCGCGTCGCCACCCCcctcaaaccaaga GCGGGG0 CGGCGGAGAGTGGCCTCCCGTGCCC00 GTCGGCGCGGC Amaioua guianensis

    Original URL path: http://ajbsupp.botany.org/v87/persson_its.txt (2016-02-14)
    Open archived version from archive


  • CACAATAACTGAGTGT GCATGATAAGGAAA AAGAACTACGGT 310 320 330 340 350 360 370 380 390 400 Alibertia acuminata Alibertia amplexicaulis ACAAAT TAGCAAG0 ATAAAATAAG0 TAAATAAATACAAG AAAAAG AAAAAGG Alibertia bertierifolia ACAAAT TASCAAG0 AGAAAATAAG0 TGAATADATAAAAGNAVGGGGWAAWNNDTKGAATTATTTRMNATTTTAAAAGAAAGGG AAAAATG Alibertia concolor ACAAAT TAGCAAG0 ATAAAATAAG0 TAAATAAATACAAG AAAAAG AAAAAGG Alibertia curviflora ACAAAN NNNNNNN0 NNNNNNTAAG1CTAATTMCATAAAAG AAGAAG MMAAAGT Alibertia edulis Alibertia elliptica ACAAAT TAGCAAG0 ATAAAATAAG0 TAAATAAATACAAG AAAAAG AAAAAGG Alibertia garapatica ACAAWT TAGCAAG0 ATWAAATAAG0 TAAWTAAATACAAG AAAAAG AAAAAGG Alibertia hassleriana ACAAAT TAGCAAG0 ATAAAATAAG0 TAAATAAATACAAG ATAAAG AAAAAGG Alibertia hispida GCAAAT TAGTAAG0 AAAAAAAAAG0 TAAATAAATAAAAG AATAAG AAAAAGG Alibertia latifolia ACAAAT TAACAAG0 AGAAAATAAG0 TAAATAAATAAAAG AAGAAG AAAAAGG Alibertia macrophylla ACAAAT TAGCAAG0 ATAAAATGGG0 TAAATAAATACAAG AAAAAG AAAAAGG Alibertia myrciifolia ACAAAT TAGCAAG0 ATAAAATAAG0 TAAATAAATACAAG AAAAAG AAAAGGG Alibertia pilosa ACAAAT TAGCAAG0 ATAAAATAAG0 TAAATAAATACAAG AAAAGG AAAAAGG Alibertia rigida ACAAAT TNGCAAG0 ANAAAANAAG0 TAAATAAATACAAG AAAAAG AAAAAGG Alibertia sessilis ACAAAT TAGAAAG0 ATAAAATAAG0 TAAATAAATACAAG AAAAAG AAAAAGG Alibertia steinbachii ACAAAT TAGCAAG0 ATAAAATAAG0 TAAATAAATACAAG AAAAAG AAAAAGG Alibertia subaurea ACAAAT TAGCAAG0 WTAAAATAKG0 TAWCCAAWTMCAAG AAAAAG AAAAAGG Alibertia aff stricta ACAAAT TAGCAAG0 ATAAAATAAG0 TAAATAAATACAAG AAAAAG AAAAAGG Alibertia tutumilla ACAAAC TAACAAG0 AGAAAATAAG0 TAAATAAATAAAAG AAGAAG AAAAAGG Alibertia utleyorum AGAAADTDTG0 TAWATAAATAAAAG AKGAAG AAAAATG Amaioua corymbosa ACAAAT TAGTGAG1 AAAAAAATAAG0 TAAATAAATAAAAG AATAAG AAAAAGG Amaioua guianensis ACAAAT TAGTAAG0 AAAAAATAAG0 TAAATAAATAAAAG AATAAG AAAAAGG Borojoa panamensis ACAAATTAGCTTAGCAAG0 AGAAAATAAG0 TAAATAAATAAAAG AAGAAG AAAAATG Borojoa patinoi ACAAAT TAGCAAG0 AGAAAATAAG0 TAAATAAATAAAAG AAGAAG AAAAAGG Borojoa sp ACAAAT TACCAAG0 AGAAAATATG0 TATATAAATAAAAG AAGAAG AAAAAGG Duroia aquatica ACAAAT TAGTAAG2AAAAAAAAGGAG0 GAAATAAATAAAAG AATAAG AAAAAGG Duroia eriopila ACAAAT TAGTAAG2AAAAAAAATAAG0 TAAATAAATAAAAG AATAAG AAAAAGG Duroia hirsuta ACAAAT TAGTAAG0 AAAAAATAAG0 TAAATAAATAAAAG AATAAG GAAAAGG Duroia micrantha ACAAAT TAGTAAG2AAAAAAAATAAG0 TAAATAAATAAAAG AATAAG AAAAAGG Genipa curviflora ACAAAT TAGCAAG2GAAAAAAATAAG0 TAAATAAATAAAAG AATAAG AAAAAGG Genipa aff williamsii ACAAAT TAGCAAG2GAAAAAAATAAG0 TAAATAAATAAAAG AATAAG AAAAAGG Glossostipula concinna ACAAAT TAGTAAG0 AAAAAATAAC0 TAAATAAATAAAAG AATAAG AAAAAGG Ibetralia GCAAAT TAGTAAG0 AAAAAAAAAG0 TAAATAAATAAAAG AATAAG AAAAAGG Kutchubaea semisericea NNNAAT TGGCAAG0 AAAAAAAAAG0 TAWATAAATAAAAG AATAAG AAAAAGG Randia tessmanii ACAAAT TAACAAG0 AGAAAATAAG0 TAAATAAATAAAAG AAGAAG AAAAAGG Species nova GCAGAT TAGCAAG0 AAAAAATAAG0 TAAATAAATAAAAG AATAGG AAAAATG Stachyarrhena ACAAAA TAGCAAG2AAAAAAAATGAG0 CAAATAAATAAAAG AATAAV AAVAAGG Randia aristeguietae GCAAAT TAGCAAG2GAAAAAGAATAA1ATAAATAAAAAGAAG AACAAGAAAAAACGA Rosenberg densiflorum GGAAGT TAGTAAG2GAAAAAGAATAA0 AAAATAAAAAT 410 420 430 440 450 460 470 480 490 500 Alibertia acuminata AACAGCGGAAG1AGA0 Alibertia amplexicaulis TTCGAATTATTTCTTATT AAAATTGTAAAACGCGAATAGCATTATCGAACAACGCAAG1AGA1AAAGAAAA Alibertia bertierifolia TTTGAATTATTTTCAATT AAAATTGCAAAACGCGAATAGCAATAT Alibertia concolor TTTGAATTATTTATTATT AAAATTGTAAAACGTGAATAGCATTATCGAACGGCGCAAG1AGA1AAAGAAAAAGCGCGTACATCGCTTTGGTCGGGCCGA Alibertia curviflora TTGHATTTATTTTCAA TACAAAACGCGAACAGCAATATCGAACRGCGGAAG1AGA0 Alibertia edulis AACAGCGGAAG1AGA0 Alibertia elliptica TTTGAATTATTTCTTATT AAAATTGTAAAACGCGAATAGCATTATCGNACGGCGCAAG1AGA1AAAGAAAAAGCGCGTACATCGCTTTGGTYGGGCCGA Alibertia garapatica TTTGAATTATTTATTATT AAAATTGTAAAACGCGAATAGCATTATCGAACAGCGCAAG1AGA1AAAGAAAAAGTGTGTACATCGCTTGGGTCGGGYCGA Alibertia hassleriana TTTGAATTATTTCTTATT AAAATTGTAAAACGCGAATAGCATTATCGAACGGTGCAAG1AGA1AAAGAAAAAGCGCGTACATCGCTTTGGTCGGGCCGA Alibertia hispida TTCGAATTATTTTTGATT AAAATTGTAAAAAGCGAATAACATTYTYGAACAGCGGGAG1GAA0 Alibertia latifolia TTCGAATTATTTTCAATC AAAATTGCAAAACGCGCACAGCAATATCGAACAGCGGAAG1AGA0 Alibertia macrophylla TTGGAATTATTTCTTATT AAAATTGTGAAACACGAATAGCATTATCGAACAGCGCAAG1AGA1AAAGAAAAAGCGCGTGCATCGCTTTGGTCGGGCCGA Alibertia myrciifolia TTTGAATTATTTCTTATT AAAATTGTAAAACGCGAATAGCATTATCGAACAGCGCAAG1AGA1AAAGAAAAAGCGCGTACATCGCTTTGGTCGGGCCGA Alibertia pilosa TTTGAATTATTTATTATT AAAATTGTAAAACGCGAATAGCATTATCGAACAGCGCAAG1AGA1AAAGAAAAAGCGTGTACATCGCTTGGGTCGGGTCGA Alibertia rigida TTNGAATTATTTCTTATT AAAATTGTAAAACGCGAATAGCATTATCGAACAGCGCAGG1AGA1AAAGAAAAAGCGCGTACATCGCTTCGGTCGGGCCGA Alibertia sessilis TTTGAATTATTTCTTATT AAAATTGTACAACGCGAATAGCATTATCGAACAGCGCAAG1AGA1AAAGAAAA Alibertia steinbachii TTTGAATTATTTATTATT AAAATTGTAAAACGCGAATAGCATTAACGAACAGCGCAAG1AGA1AAAGAAAAAGCGTGTACATCGCTTGGGTCGGGTCGA Alibertia subaurea CTKGACTTATTTCTTATT AAAATTGTAAAACACGAWTAGCATTATCGAACCSCCCAGG1AGA1AARGAAAAAGCGCGTGCATCGCTTTGKTCGAGCCGA Alibertia aff stricta TTCGAATTATTTCTTATT AAAATTGTAAAACGCGAATAGCATTATCGAACAACGCAAG1AGA1AAAGAAAA Alibertia tutumilla TTCGAATTATTTTCAATC GAAATTGCAAAACGCGAACAGCAATATCGAACAGCGGAAG1AGA0 Alibertia utleyorum TTTGAATTATTTTCAATT AAAATTGTAAAACGCG ACAGCATTMTCGMACAGCGGAAG1AGA0 Amaioua corymbosa TTTGAATTATTTTCTAGT AAAATTGTAAAACGCGAATAGCATTCTCGAATAGCGGRAG1AAA0 Amaioua guianensis TTTGAATTATTTTCTATT AAAATCGTAAAATGCGAATAGAATTCTCGAGTAGCGGAGG1AAA0 Borojoa panamensis TTTGAATTATTTTCAATC AAAATTGCAAAACGCGAACAGCAATATCGAACAGCGGAAG1AGA0 Borojoa patinoi TTTGAATTATA GAAA AAAAAGCGAGCAGCAATATCGAACAGCGGAAG1AGA0 Borojoa sp TTCGAATTATTTTCAATC GAAATTGCAAAACGCGAACAGCAATATCGAACAGCGGAAG1AGA0 Duroia aquatica TTTGAATTATTTTCTATT AAAATTGTAAAACGCGAATAGCATTCTCGAATAGCGGAAG1AAA0 Duroia eriopila TTTGAATTATTTTCTATT AAAATTGTAAAACGCGAATAGCATTSTCGAATAGCGGAAG1AAA0 Duroia hirsuta TTTGAATTATTTTCTATT AAAATCGTAAAACGCGAATAGCATTCTCGAATAGCGGAAG1AAA0 Duroia micrantha TTTGAATTATTTTCTATT AAAATTGTAAAACGCGAATAGCATTGTCGAATAGCGGAAG1AAA0 Genipa curviflora ATTGAATTATTTTCTATT AAATTTGTAAAAAGCGAATAACATTCCCGAACAGCGGGAG1AGA0 Genipa aff williamsii TTTGAATTATTTTCTATT AAATTTGTAAAAAGCGAATAACATTCCCGAACAGCGGGAG1AGA0 Glossostipula concinna TTTRAATGATTTTCTAAT AAAATTGKAAAAAGCGAATAACATTCTCGAACAGCGGGAG1AGA0 Ibetralia TTCGAATTATTTTTGATT AAAATTGTAAAAAGCGAATAACATTYTYGAACAGCGGGAG0 GA0 Kutchubaea semisericea TTCGAATTATTTTTGATT AAAATATTAAAAAGCGAATAACATTCTCGAACGGTGGGAG0 GT0 Randia tessmanii TTCGAATTACTTTCAATC GAAATTGCAAAACGCGAACAGCAATATCGAACAGCGGAAG1AGA0 Species nova TTTGAATTATTTTGTATTAAAAACTGTAGAACGCGAATACCGTTCTCGAACAGCGGAAG0 GA0 Stachyarrhena TBSVAATTGTTTTCTATT AAAATTGCAAAACGCGAATACCATTCCCGAACGGCGAAAG1NNA0 Randia aristeguietae CTCGGGTCATGTTCGAAT GAAATTGCGAATACCGTA GTCGAGTGGCGGAAG1GAA0 Rosenberg densiflorum 510 520 530 540 550 560 570 580 590 600 Alibertia acuminata AAA1AAA2GA GGYGCGCGCT0 0 TCGC TTTGGTCGGGT Alibertia amplexicaulis Alibertia bertierifolia Alibertia concolor GTTGGGGGCTTGTATTGAAACTCGACCGCAAAAAGACACCTAAGAGCAAGAGAAAAGAA0 Alibertia

    Original URL path: http://ajbsupp.botany.org/v87/persson_5s.txt (2016-02-14)
    Open archived version from archive



  •