archive-org.com » ORG » B » BOTANY.ORG

Total: 33

Choose link from "Titles, links and description words view":

Or switch to "Titles and links view".

  • TAAAATTCCTG GTAATACAAGAAATAAGATAGGATCCCTTAGTGCTCCC TTTGGGGCTAAAAACACTTTTGTCTATCCTCATGAA ACGGGAAATACTATGCTATATCCTCTTCTTATATTACTGCTTTTTACTTTGTTCATTGGATCCATAGGAATCTATTTTGA TAATGG AATATCGGAATTAAGCATATTATCAAAGTGGCTAACTCCTTCGATAAACTTTTTCCAGG AAAGTTCTAATTCTTCCATAAATTCTTATGAATTTCTAACTAATGCAATTTATTCTGTAAGTTTAGCAATTTTTGGTCTA TTCATAGCATATATCTTCTATGGATCCGCTTATTATTTTTTTCAGAATTTGAATTTTCAAAATTCCCTTGTAAAAATAAA AAGGAATCCAAAAAAGAACTTTTTGGA TGAAGTAAAAAAAAAGATATACAGCTGGTCATATAATCGTGGTTATA TAGATGTTTTCTATACTAGGGTATTTATCCTGGGTATAAAAACATTATCNGAACTAACACATTTTTTCGATAAAGGTGTC ATTGATANAATTCCCATTNGAATA Panicum aquaticum ATGTCAATGGGATTTGGACTTTTTCTTATTCCGACAGCAACAAAAAATCTTCGTCGCATATGGGCTTTTCCTAGTATTTT ACTCTTAAGTATAGCTCTGGTATTCTCAGTTCACCTGTCTATTCAACAAATAAATGGAAGTTCTATCTATCAATATCTAT GGTCTTGGACCATCAATAATGATTTTTCCTTAGAATTTGGATACTTGATCGACCCCCTTACGTCTATTATGTTAATACTA ATTACTACTGTAGGAATCTTGGTTCTTATTTATAGTGACGATTATATGTCTCACGATGAAGGATATTTGAGATTTTTTGT TTATATAAGTTTTTTTAATACTGCCATGTTGGGATTGGTTACTAGTTCCAATTTGATACAAATTTATTTTTTTTGGGAAC TTGTCGGAATGTGTTCCTATTTATTAATAGGTTTTTGGTTTACACGGCCAATTGCAGCGAGTGCTTGCCAAAAAGCTTTT GTAAATAATYGTGTAGGGGATTTTGGTCTGTTATTAGGAATTTTAGGTTTTTTTTGGATAACGGGTAGTTTAGAGTTTCG GGATTTGTTCAAAATAGCTAATAACTGGATTCCTAATAATGGGATTAATTCCTTACTTACTACTTTGTGTGCTTTTTTAT TATTCCTTGGTGCAGTTGCAAAATCTGCACAATTCCCTCTTCACGTATGGTTACCCGATGCTATGGAAGGGCCCACTCCC ATTTCGGCTCTTATACACGCAGCAACTATGGTTGCTGCGGGGATTTTTCTTCTAGCTCGACTTCTTCCTCTTTTCATATC CTTACCTTTGATAATGAGTTTTATTTCTTTAGTAGGTACAATAACACTCTTCTTAGGAGCCACTTTAGCTCTTGCTC AGAGAGATATTAAAAGAAGCTTAGCCTATTCTACAATGTCTCAATTGGGTTATATGATGTTAGCTCTAGGTATAGGT TCTTATGAAGCTGCTTTATTCCATTTGATCACTCATGCTTATTCGAAAGCTTTATTGTTCTTAGGATCCGGATCCGTTAT TCATTCAATGGAATCTCTTGTTGGATATTCACCAGATAAAAGTCAGAATATGGTTCTTATGGGTGGTTTAAGAAAATACG TTCCAATTACAAGAACTACTTTTTTATGTGGTACACTTTCTCTTTGTGGTATTCCACCTCTTGCTTGCTTCTGGTCCAAA GATGAAATCCTTAGTAATAGTTGGTTGTATTCACCCTTTTTTGGAATAATAGCCTCTTTTACTGCAGGATTAACAGCATT TTATATGTTTCGNNNGTATGTACTTACTNGGGAGGGGTATTTACGTGTTCATTTCCAAAATTACAACAGTACTAAAGAAG GTTCGTNGTATTCAATATCCTTATGGGGAAAAGGCCTATCCAAAGGAGTCAATAGGGATTTTGTTTTATCAACAATGAAG GGTGGAGTTTCTTTTTTTTCACAAAATATACC CCAAATTCCTGGTAATACCAGAAATAAGATAGGATCCTTTAG CACTCCC TTTGAGGCTAAAAACACTTTTGTCTATCCTCATGAAACGGGAAATACTATGCTATTTCCTCTTCTTA TATTACTGCTTTTTACTTTGTTCATTGGATCCATAGGAATCCATTTTGATAATGGAATAAAGGGTAATGGAATATCGGAG TTAACCATATTATCAAGGTGGCTAACTCCTTCAATAAACTTTTTCCAGGAAAGTTCTAATTCTTCCATAAATTCATATGA ATTTATCATTAATGCAATTTCTTCTGTAAGTTTAGCAATTCTTGGTCTATTCATAGCATATATCTTCTATGGATCTACTT ATTCTTTTTTTCAAAATTTAAATTTTCTAAATTCCCTTGT AAAAGGGAATCCAAAAAAGAACTTTTTGGA TGAAGTAAAAAAAAAGATATACAGCTGGTCATATAATCGTGGTTATATAGATGTTTTCTATACTAGGGTCTTTATCTT GGGTATAAGAGGATTAGCTGAACTAACGAATTTTTTTGATAAGGGTGTCATTGATGGAATTATCAATGGAGTA Panicum obtusum ATGTCAATGGGATTTGGACTTTTTCTTATTCCGACAGCAACAAAAAATCTTCGTCGCATATGGGCTTTTCCTAGTATTTT ACTCTTAAGTATAGCTATGGTATTCTCAGTTCACCTGTCTATTCAACAAATAAATGGAAGTTCTATCTATCAATATCTAT GGTCTTGGGCCATCAATAATGATTTTTCCTTAGAATTTGGATACTTGATCGACCCCCTTACGTCTATTATGTTAATACTA ATTACTACTGTAGGAATCTTGGTTCTTATTTATAGTGACGATTATATGTCTCACGATGAAGGATATTTGAGATTTTTTGT TTATATAAGTTTTTTTAATACTTCCATGTTGGGATTGGTTACTAGTTCCAATTTGATACAAATTTATTTTTTTTGGGAAC TTATCGGAATGTGTTCCTATTTATTGATAGGCTTTTGGTTTACACGGCCAATTGCAGCGAGTGCTTGTCNNNNNNNNNNN NNNNNN GGGGATTTTGGTCTTTTATTAGGGATTTTAGGTTTTTTTTGGATAACGGGTAGTTTAGAGTTTCG GGATTTGTTCAAAATAGCTAATAACTGGATTCCTAATAATGGGATTAATTCCTTACTTACTACTTTGTGTGCTTTTTTAT TATTCCTTGGTGCAGTTGCAAAATCTGCACAATTCCCTCTTCACGTATGGTTACCCGATGCTATGGAAGGACCCACTCCC ATTTCGGCTCTTATACACGCAGCAACTATGGTTGCCGCGGGGATTTTTCTTTTGGCTCGACTTCTTCCTCTTTTCATATCTCTACCCTTGATAATGAGTTTCATTTCTTTAGTAGGTACAATAACACTCTTCTTAGGAGCCACTTTAGCTCTTGC TC AGAGAGATATTAAAAAAATTTTAGCCTATTCTACAATNTCTCAATTGGGTTATATGATGTTAGCTCTAGGTA TAGGTTCTTATCAAGCTGCTTTATTCCATTTGATCACGCATGCTTATTCGAAAGCTTTATTGTTCTTAGGATCGGGATCC ATTATTCATTCAATGGAACCTCTTGTTGGATATTCACCAGATAAAAGTCAGAATATGGTTCTTATGGGCGGTTTAAGAAA ATACATTCCAATTACAAGAACTACTTTTTTATGTGGTACACTTTCTCTTTGTGGTATTCCACCTCTTGCTTGCTTCTGGT CCAAAGATGAAATCCTTAGTAATAGTTGGTTGTATTCACCCTTTTTTGGAATTATAGCCTCTTTTACTGCAGGATTAACT GCATTTTATATGTTTCGGATATATTTACTTACTTTTGATGGGTATTTGCGTGTTCATTTTCAAAATTACAGCAGTACTAA AGAAGGTTCGTTGTATTCAATATCCTTATGGGGAAAAGGTATATCCAAAGGAGTCAATAGGGATTTTGTTTTATCAACAA CGAAGAGTGGAGTTTCTTTTTTTTCACAAAATATACC TAAAATTCCTCGTAATACAAGAAATAACAAGGGATCC TTTAGTACTCCC TTTGGGGCTAAAAACACTTTTGTCTATCCACATGAAACGGGAAATACTATGCTATATCCTCT TCTTATATTACTGCTTTTTACTTTGTTCATTGGATCCATCGGAATCCATTTTGATAATGGAGTAAAGGATAATGGAATAT CGGAGTTAACCATATTATCAAGGTGGCTAACTCCTTCACTAAACTTTTTCCAGGAAAGTTCTAATTCTTCCATAAATTCC TANGAATTTATCACTAATGCAATTTCTTCTGTAAGTTTAGCAATTTTGGGTCTATTCATAGCATATATTTTCTATGGATC CGCTTATTATTTTTTTCAGAATTTGAATTTCCAAAATTCCCTTGTAAAAATAAAAAAGAATCCAAAAAATAACTTTTTGG A TGAAGTAAAAAAAAAGATATACAGCTGGTCATATAATCGTGGTTATATAGATGTTTTCTATACTAGGGTATTT ATCCTGGGTATAAGAAAATTAGCANAACTAACACATTTTTTCGATAAAGGTGTCATTGATGGAATTACCAATGGAGTG P anicum millegrana ATGTCAATGGGATTTGGACTTTTTCTTATTCCGACAGCAACAAAAAATCTTCGTCGCATATGGGCTTTTCCTAGTATTTT ACTCTTAAGTATAGCTCTGGTATTTTCAGTTCACCTGTCTATTCAACAAATAAATGGAAGTTCTATCTATCAATATCTAT GGTCTTGGACCATCAATAATGATTTTTCCTTAGAATTTGGATACTTGATCGACCCCCTTACGTCTATTATGTTAATACTA ATTACTACTGTAGGAATCTTGGTTCTTATTTATAGTGACGATTATATGTCTCACGATGAAGGATATTTGAGATTTTTTGT TTATATAAGTTTTTTTAATACTGCCATGTTGGGATTGGTTACTAGTTCCAATTTGATACAAATTTATTTTTTTTGGGAAC TTGTCGGAATGTGTTCCTATTTACTGATAGGCTTTTGGTTTACACGGCCAATTGCAGCGAGTGCTTGCCAAAAAGCTTTT GTAACTAATCGTGTAGGGGATTTTGGTCTGTTATTAGGAATTTTAGGTTTTTTTTGGATAACGGGTAGTTTAGAGTTTCG GGATTTGTTCAAAATAGCTAATAACTGGATTCCTAATAATGGGATTAATTCCTTACTTACTACTTTGTGTGCTTTTTTAT TATTCCTTGGTGCAGTTGCAAAATCTGCACAATTCCCTCTTCACGTATGGTTACCCGATGCTATGGAAGGACCCACTCCC ATTTCGGCTCTTATACACGCAGCAACTATGGTTGCTGCGGGGATTTTTCTTTTAGCTCGACTTCTTCCTCTTTTCATATC CCTACCCTTGATAATGAGTTTTATTTCTTTAGTAGGTACAATAACACTCTTCTTAGGAGCCACTTTAGCTCTTGCTC AGAGAGATATTAAAAGAAGCTTAGCCTATTCTACAATGTCTCAATTGGGTTATATGATGTTAGCTCTAGGCATAGGT TCTTCTCAAGCTGCTTTATTCCATTTGATCACTCATGCTTATTCGAAAGCTTTATTGTTCTTAGGATCCGGATCCGTTAT TCATTCAATGGAACCTCTTGTTGGATATTCACCAGATAAAAGTCAGAATATGGTTCTTATGGGTGGTTTAAGAAAATACG TTCCAATTACAAGAACGACTTTTTTATGTGGTACACTTTCTCTTTGTGGTATTCCACCTCTTGCTTGCTTCTGGTCCAAA GATGAAATCCTTAGTAATAGTTGGTTGTATTCACCCTTTTTTGGAATAATAGCCTCTTTTACTGCAGGATTAACCGCATT TTATATGTTTCGGNNNNNNNNNNNN GATGGGTATTTGCGTGTTCATTTTCAAAACTACAGCAGTACTACAGAAG GTTCGTTGTATTCAATATCCTTATGGGGAAAAGGCATATCCAAAGGAGTCAATAKGGATTTTGTTTTATCAACAATGAAG AGTGGGGTTTCTTTTTTTTCACAAAATATACC CAAAATTCCTGGTAATACAAGAAATAAGATAGGGTCCTTTAG TACTCCC TTTGTGGCTAAAAACACTTTTGTCTATCCTCATGAAACGGGAAATACTATGCTATTTCCTCTTCTTA TATTACTGCTTTTTACTTTGTTCATTGGATCCATAGGAATCCATTTTGATAATGGAATAAAGGGTAATGGAATATCGGAG TTAACCATATTATCAAAGTGGCTAACTCCTTCAATAAACTTTTTCCAGGAAAGTTCTAATTCTTCCATAAATTCATATGA ATTTCTCACTAATGCAATTTCTTCTGTAAGTTTAGCAATTTTTGGTCTATTCATAGCATATATCTTCTATGGATNNNNTT ATTCTTTTTTTCAGAATTTGAATTTTCTAAATTCCCTTGT AAAAGGGAATCCAAAAAAGAACTTTTTGAA TGAAGTAAAAAAAAAGATATACAGCTGGTCATATAATCGTGGTTATATAGATGTTTTCTATACTAGGGTCTTTATCTT GGGTATAAGAAGATTAGCCGAACTAACGCATTTTTTCGATAAAGGTGTCATTGATGGAATTACCAATGGAGTA Panicum rudgei ATGTCAATGGGATTTGGACTTTTTCTTATTCCGACAGCAACAAAAAATCTTCGTCGCATATGGGCTTTTCCTAGTATTTT ACTCTTAAGTATAGCTCTGGTATTCTCAGTTCACCTGTCTATTCAACAAATAAATGGAAGTTCTATCTATCAATATCTAT GGTCTTGGACCATCAATAATGATTTTTCCTTAGAATTTGGATACTTGATCGACCCCCTTACGTCTATTATGTTAATACTA ATTACTACTGTAGGAATCTTGGTTCTTATTTATAGTGACGATTATATGTCTCACGATGAAGGATATTTGAGATTTTTTGT TTATATAAGTTTTTTTAATACTGCCATGTTGGGATTGGTTACTAGTTCCAATTTGATACAAATTTATTTTTTTTGGGAAC TTGTCGGAATGTGTTCCTATTTATTGATAGGCTTTTGGTTTACACGGCCAATTGCAGCGAGTGCTTGCCAAAAAGCTTTT GTAACTAATCGTGTAGGGGATTTTGGTCTGTTATTAGGAATTTTAGGTTTTTTTTGGATAACGGGTAGTTTAGAGTTTCG GGATTTGTTCAAAATAGCTAATAACTGGATTCCTAATAATGGGATTAATTCCTTACTTACTACTTTGTGTGCTTTTTNAT NATNCCTTGGTGCAGTTGCAAAATCTGCACAATTCCCTCTTCACGTATGGTTACCCGATGCTATGGAAGGGCCCACTCCCATTTCGGCTCTTATACACGCA GCAACTATGGTTGCTGCGGGGATTTTTCTTATAGCTCGACTTCTTCCTCTTTTCATATCCTTACCTTTGATAATGAGTTT TATTTCTTTAGTAGGTACAATAACACTCTTCTTAGGAGCCACTTTAGCTCTTGCTC AGAGAGATATTAAAAGAA GCTTAGCCTATTCTACAATGTCTCAATTGGGTTATATGATGTTAGCTCTAGGTATAGGTTCTTATGAAGCTGCTTTATTC CATTTGATCACTCATGCTTATTCGAAAGCTTTATTGTTCTTAGGATCCGGATCCGTTATTCATTCAATGGAATCCCTTGT TGGATATTCACCAGATAAAAGTCAGAATATGGTTCTTATGGGTGGTTTAAGAAAATACGTTCCAATTACTAGAACTACTT TTTTATGTGGTACACTTTCTCTTTGTGGTATTCCACCTCTTGCTTGCTTCTGGTCCAAAGATGAAATCCTTAGTAATAGT TGGTTGTATTCACCCTTTTTTGGAATAATAGCCTCTTTTACTGCAGGATTAACCGCATTTTATATGTTTNNNNNNNNNN AAAGAAGGTTCGTTGTATTCAATATCCT TATGGGGAAAAGGCCTATCCAAAGGAGTCAATAGGGATTTTGTTTTATCAACAATGAAGGGTGGAGTTTCTTTTTTTTCC AAAAATATACC CCAAATTCCTGGTAATACAAGAAATAAGATAGGATCCTTTAGGACTCCC TTTGAGGC TAAAAACACTTTANTCTATCCTCATGAAACGGGAAATACTATGCTATTTCCTCTTCTTATATNACTGCTTTTTACTTTGT TCATTGGATCCATAGGAATCCATTTTGATAATGGAATAAAGGGTAATGGAATATCGGAGTTAACCATATTATCAAAGTGG CTAACTCCTTCAATACACTTTTTCCAGGAAAGTTCGAATTCTTCCATAAATTCATATGAATTTCTCATTAATGCAATTTC TTCTGTAAGYNTAGCAATTCTTGGTCTATTCATAGCATATATCTTCTATGGATCTACTTATTCTTTTTTTCAGAATTTAA ATTTTCTAAATTCCCTTGT AAAAGGGAATCCAAAAAAGAACTTTTTAGA TGAAGTAAAAAAAAAGATA TACAGCTGGTCATATAATCGTGGTTATATAGATGTTTTCTATACTAGGGTATTTATCTTGGGTATAANAGGATTAGCTGA ACTAACGAATTTTTTTGATAAGGGTGTCATTGATGGAATTATCAATGGAGTA Paspalidium geminatum ATGTCAATGGGATTTGGACTTTTTCTTATTCCGACAGCAACAAAAAATCTTCGTCGCATATGGGCTTTTCCTAGTATTTT ACTCTTAAGTATAGCTCTGGTATTCTCAGTTCACCTGTCTATTCAACAAATAAATGGAAGTTCTATCTATCAATATCTAT GGTCTTGGACCATCAATAACGATTTTTCTTTAGAATTTGGATACTTGATCGACCCTCTTACGTCTATTATGTTAATACTA ATTACTACTGTAGGAATCTTGGTTCTTATTTATAGTGACGATTATATGTCTCACGATGAAGGATATTTGAGATTTTTTGT TTATATAAGTTTTTTTAATACTGCCATGTTGGGGTTGGTTACTAGTTCCAATTTGATACAAATTTATTTTTTTTGGGAAC TTGTCGGAATGTGTTCCTATTTATTGATAGGCTTTTGGTTTACACGGCCAATTGCAGCGAGTGNTTGCCAAAAAGCTTTT GTAACTAATCGTGTAGGGGATTTNGGTCTGTTATTAGGAATNGTAGGTTTTTTTTGGATAACGGGTAGTTTANAGTTTCG GGATTTGTTCAAAATAGCTAATAACTGGATTCCTAATAATGGGATTAATTCCTTACTTACTACTTTGTGTGCTTTTTTAT TATTCCTTGGTGCAGTTGCAAAATCCGCACAATTCCCTCTTCACGTATGGTTACCCGATGCTATGGAAGGACCCACTCCC ATTTCGGCTCTTATACACGCAGCAACTATGGTTGCTGCGGGGATTTTTCTTTTAGCTCGACTTCTTCCTCTTTTCATATC CCTACCCTTGATAATGAGTTTTATTTCTTTAGTAGGTACAATAACACTCTTCTTAGGAGCCACTTTAGCTCTTGCTC AGAGAGATATTAAAAAAANCTTATCCTATTCTACAATGTCTCAATTGGGTTATATGATGTTAGCTCTCGGTATAGGT TCTTATGAAGCTGCTTTATTCCATTTGATCACTCATGCTTATTCGAAAGCTTTATTGTTCTTAGGATCCGGATCCGTTAT TCATTCAATGGAACCTCTTGTTGGATATTCACCAGATAAAAGTCAGAATATGGTTCTTATGGGTGGTTTAAGAAAATACG TTCCAATTACAAGAACTACTTTTTTATGTGGTACACTTTCTCTTTGTGGTATTCCACCTCTTGCTTGCTTCTGGTCCAAA GATGAAATCCTTAGTAATAGCTGGTTGTATTCACCTTTTTTTGGAATAATAGCCTCTTTTACTGCAGGATTAACNGCATT TTATATGTTTCGGATATATTTACTTACTTTTGATGGGTATTTGCGTGTTCATTTTCAAAATTACAGCAGTACTAAAGAAG GTTCGTTGTATTCAATATCCTTATGGGGAAAAGGCATATCCAAAGGAGTCAATAGAGATTTTGTTTTATCAACAATGAAG GGTGGAGTTTCTTTTTTTTCACAAAATATACC CCAAATTCCTGGTAATACAAGAAATAAGATAGGATCCTTTAG TACTCCC TTTGGGGCTAAAAAAACTTTTGTCTATCCTCATGAAACGGGAAATACTATGCTATTTCCTCTTCTTA TATTACTGCTTTTTACTTTGTTCATTGGATCCATAGGAATCCATTTTGATAATGGAATAAAGGGTAATGGAATATCGGAG TTAACCATATTATCAAAGTGGCTAACTCCTTCAATAAACTTTTTCCAGGAAAGTTCTAATTCTTCCATAAATTCATATGA ATTTCTCATTAATGCAATTTCTTCTGTAAGTTTAGCAATTCTTGGTCTATTCATAGCATATATCTTCTATGGATCTACTT ATTCTTTTTTTCAGAATTTGAATTTTCTAAATTCCCTTGT AAAAGGGAATCCAAAAAAAAACTTTTTGGA TCAAGTAAAAGAAAAGATATACAGCTGGTCATATAATCGTGGTTATATAGACGTTTTCTATACTAGGGTCTTTATCTT GGGTATAAGAANATTAGCCGAACTAACGAATTTTTTCGATAAGGGTGTTATTGATGGAATTATCAATGGANTA Paspalum arundinellum ATGTCAATGGGATTTGGACTTTTTCTTATTCCGACAGCAACAAAAAATCTTCGTCGCATATGGGCTTTTCCTAGTATTTT ACTCTTAAGTATAGCTATGGTATACTCGGTTCACCTGTCTATTCAACAAATAAATGGAAGTTCTATCTATCAATATCTAT GGTCTTGGGCCATCAATAATGATTTTTCCTTAGAATTTGGATACTTGATCGACCCCCTTACGTCTATTATGTTAATACTA ATTACTACTGTAGGAATCTTGGTTCTTATTTATAGTGACGATTATATGTCTCACGATGAAGGATATTTGAGATTTTTTGT TTATATAAGTTTTTTTAATACTTCCATGTTGGGATTGGTTACTAGTTCCAATTTGATACAAATTTATTTTTTTTGGGAAC TTATCGGAATGTGTTCCTATTTATTGATAGGCTTTTGGTTTACACGGCCAANGCCNNNNNNNNNNNNNNNNN TTGTTTTGGATAACGGGTAGTTTAAAGTTTCGGGATTTGTTCAAAATANCTAATAACTGGATTCCTAATAATGGGATTA ATTCCTTACTTACTACTTTGTNTGCTTTTTTATTATTCCTTGGTGCAGTTGCAAAATCTGCACAATTCCCTCTTCACGTA TGGTTACCCGATGCTATGGAAGGACCCACTCCCATTTCGGCTCTTATACACGCAGCAACCATGGTTGCCGCGGGGATTTT TCTTTTGGCTCGACTTCTTCCTCTTTTCATATCTCTACCCTTGATAATGAGTTTAATTTCTTTAGTAGGTACAATAACAC TCTTCTTAGGGGCCACTTTAGCTCTTGCTC AGAGAGATATTAAAAGAATTTTAGCCTATTCTACAATGTCTCAA TTGGGTTATATGATGTTAGCTCTAGGTATAGGTTCTTATCAAGCTGCTTTATTCCATTTGATCACTCATGCTTATTCGAA AGCTTTATTGTTCTTAGGATCGGGATCCATTATTCATTCAATGGAACCTCTTGTTGGATATTCACCAGATAAAAGTCAGA ATATGGTTCTTATGGGCGGTTTAAGAAAATACATTCCAATTACAAGAACTACTTTTTTATGTGGTACACTTTCTCTTTGT GGTATTCCACCTCTTGCTTGCTTCTGGTCCAAAGATGAAATCCTTAGTAATAGTTGGTTGTATTCACCCTTTTTTGGAAT TATAGCCTCTTTTACTGCAGGATTAACTGCATTTTATATGTTTCGGATATATTTACTTACTTTTGATGGGTATTTGCGTG TTCATTTTCAAAATTACAGCAGTACTAAAGAAGGTTCGTTGTATTCAATATCCTTATGGGGAAAAGGTATATCCAAAGGA GTCAATAGGGAGTTTGTTTTATCAACAACGAAGAGTGGAGTTTCTTTTTTTTCACAAAATATACC TAAAATTCC TCGTAATAGAAGAAATCAGAAGGGATCCTTTAGTGCTCCC TTTGGGGCTAAAAACACTTTTGTCTATCCACATG AAACGGGAAATACTATGCTATATCCTCTTCTTATATTACTGCTTTTTACTTTGTTCATTGGATCCATGGGAATCCATTTT GATAATGGAGTAAAGGATAATGGAATATCAGAGTTAACCATATTATCAAGGTGGCTAACTCCTTCTATAAACTTTTTCCA GGAAAGTTCTAATTCTTCCATANATTCCTATGAATTTCTCACTAATGCAATTTCTTCTGTAAGTNNAGCAATTTGGGGTC TATTCATAGCANATATTTTCTAGGGATCCGNNTATTATTTTTTTCAGAATTGGAATTTCCAAAATTCCCTTGTNNNNATA AAAAAGAATCCAAAAAAGAACTTTTTGGA TGAAGTAAAAAAAAAGATATACAGCTGGTCATATAATCGTGGTTA TATGGATGTCTTCTATACTAGGGTATTTATCCTGGGTATAAAAAAATTAGCGGAACTAACACATTTTTTCGATAAAGGTG TCATTGATGGAATTATCAATGGAGTG Paspalum haumanii ATGTCAATGGGATTTGGACTTTTTCTTATTCCGACAGCAACAAAAAATCTTCGTCGCATATGGGCTTTTCCTAGTATTTT ACTCTTAAGTATAGCTATGGTATACTCGGTTCACCTGTCTATTCAACAAATAAATGGAAGTTCTATCTATCAATATCTAT GGTCTTGGGCCATCAATAATGATTTTTCCTTAGAATTTGGATACTTGATCGACCCCCTTACGTCTATTATGTTAATACTA ATTACTACTGTAGGAATCTTGGTTCTTATTTATAGTGACGATTATATGTCTCACGATGAAGGATATTTGAGATTTTTTGT TTATATAAGTTTTTTTAATACTTCCATGTTGGGATTGGTTACTAGTTCCAATTTGATACAAATTTATTTTTTTTGGGAAC TTATCGGAATGTGTTCCTATTTATTGATAGGCTTTTGGTTTACACGGCCAATTGCAGCGAGTGCTTGTCAAAAAGCTTTN GTAACTAATCGTGTAGGGGATTTTGGTCTTTTATTAGGAATTTTAGGTTTTTTTTGGATAACGGGTAGTTTAGAGTTTCG GGATTTGTTCAAAATAGCTAATAACTGGATTCCTAATAATGGGATTAATTCCTTACTTACTACTTTGTGTGCTTTTTTAT TATTCCTTGGTGCAGTTGCAAAATCTGCACAATTCCCTCTTCACGTATGGTTACCCGATGCTATGGAAGGACCCACTCCC ATTTCGGCTCTTATACACGCAGCAACTATGGTTGCCGCGGGGATTTTTCTTTTGGCTCGACTTCTTCCTCTTTTCATATC TCTACCCTTGATAATGAGTTTAATTTCTTTAGTAGGTACAATAACACTCTTCTTAGGGGCCACTTTAGCTCTTGCTC AGAGAGATATTAAAAGAAGTTTAGCCTATTCTACAATGTCTCAATTAGGTTATATGATGTTAGCTCTAGGTATAGGT TCTTATCAAGCTGCTTTATTCCATTTGATCACTCATGCTTATTCGAAAGCTTTATTGTTCTTAGGATCGGGATCCATTAT TCATTCAATGGAACCTCTTGTTGGATATTCACCAGATAAAAGTCAGAATATGGTTCTTATGGGCGGTTTAAGAAAATACA TTCCAATTACAAGAACTACTTTTTTATGTGGTACACTTTCTCTTTGTGGTATTCCACCTCTTGCTTGCTTCTGGTCCAAA GATGAAATCCTTAGTAATAGTTGGTTGTATTCACCCTTTTTTGGAATTATAGCCTCTTTTACTGCAGGATTAACCGCATT TTATATGTTTCGGATATATTTACTTACTTTTGATGGGTANTTGCGNGNTCATTCTCAAAANNACAGCAGTACTAAAGAAG GGTCGTTGNATTCAATATCCTTATGGGGAAAAGGTATATCCAAAGGAGTCAATAGGGAGTTTGTTTTATCAACAACGAAG AGTGGAGTTTCTTTTTTTTCACAAAATATACC TAAAATTCCTCGTAATGGAAGAAATCAGAAGGGATCCTTTAG TGCTCCC TTTGGGGCTAAAAACACTTTTGTCTATCCACATGAAACGGGAAATACTATGCTATATCCTCTTCTTA TATTACTGCTTTTTACTTTGTTCATTGGATCCATGGGAATCCATTTTGATAATGGAGTAAAGGATAATGGAATATCGGAG TTAACCATATTATCAAGGTGGCTAACTCCTTCTATAAACTTTTTCCAGGAAAGTTCTAATTCTTCCATAAATTCCTATGA ATTTCTCACTAATGCAATTTTTTCTGTAAGTTTAGCAATTTTGGGTCTATTCATAGCATATATCTTCTATGGATCCGCTT ATTATTTTTTTCAGAATTTGAACTTCCAAAATTCCCTTGTAAAAATAAAAAAGAATCCAAAAAAGAACTTTTTGGA TGAAGTAAAAAAAAAGATATACAGCTGGTCATATAATCGTGGTTATATGGATGTTTTCTATACTAGGGTATTTATCCT GGGTATAAAAAAATTAGCGGAACTAACACATTTTTTCGATAAAGGTGTCATTGATGGAATTATCAATGGAGTG Paspalum vaginatum ATGTCAANGGGATTTGGACTTTTTCTTATTCCGACAGCAACAAAAAATCTTCGTCGCATATGGGCTTTTCCTAGTATTTT ACTCTTAAGTATAGCTATGGTATTCTCGGTTCACCTGTCTATTCAACAAATAAATGGAAGTTCTATCTATCAATATCTAT GGTCTTGGGCCATCAATAATGATTTTTCCTTAGAATTTGGATACTTGATCGACCCCCTTACGTCTATTATGTTAATACTA ATTACTACTGTAGGAATCTTGGTTCTTATTTATAGTGACGATTATATGTCTCACGATGAAGGATATTTGAGATTTTTTGT TTATATAAGTTTTTTTAATACTTCCATGTTGGGATTGGTTACTAGTTCCAATTTGATACAAATTTATTTTTTTTGGGAACTTATCGGAATGTGTTCCTATTTATTGATAGGCTTTTGGTTTACACGGCCAATTGCAGCGAGTGCTTGTCAAAA AGCTTTTGTAACTAATNGTGTAGGGGATTTTGGTNTTTTATTAGGAATTTTAGGTTTTTTTTGGATAACGGGTAGTTTAG AGTTTCGGGATTTGTTCAAAATAGCTAATAACTGGATTCCTAATAATGGGATTAATTCCTTACTTACTACTTTGTGTGCT TTTTTATTATTCCTTGGTGCAGTTGCAAAATCTGCACAATTCCCTCTTCACGTATGGTTACCCGATGCTATGGAAGGACC CACTCCCATTTCGGCTCTTATACACGCAGCAACTATGGTTGCCGCGGGGATTTTTCTTTTGGCTCGACTTCTTCCTCTTT TCATATCTCTACCCTTGATAATGAGTTTAATTTCTTTAGTAGGTACAATAACACTCTTCTTAGGAGCCACTTTAGCTCTT GCTC AGAGAGATATTAAAAGAAGTTTAGCCTATTCTACAATGTCTCAATTAGGTTATATGATGTTAGCTCTAGG TATAGGTTCTTATCAAGCTGCTTTATTCCATTTGATCACTCATGCTTATTCGAAAGCTTTATTGTTCTTAGGATCGGGAT CCATTATTCATTCAATGGAACCTCTTGTTGGATATTCACCAGATAAAAGTCAGAATATGGTTCTTATGGGCGGTTTAAGA AAATACATTCCAATTACAAGAACTACTTTTTTATGTGGTACACTTTCTCTTTGTGGTATTCCACCTCTTGCTTGCTTCTG GTCCAAAGATGAAATCCTTAGTAATAGTTGGTTGTATTCACCCTTTTTTGGAATTATAGCCTCTTTTACTGCAGGATTAA CTGCATTTTATATGTTTCGGATATATTTACTTACTTTTGATGGGTATTTGCGTGTTCATTTTCAAAATTACAGCAGTACT AAAGAAGGTTCGTTGTATTCAATATCCTTATGGGGAAAAGGTATATCCAAAGGAGTCAATAGGGATTTTGTTTTATCAAC AACGAAGAGTGGAGTTTCTTTTTTTTCACAAAATATACC TAAAATTCCTCGTAATACAAGAAATCAGAAGGGAT CCTTTAGTGCTCCC TTTGGGGCTAAAAACACTTTTGTTTATCCACATGAAACGGGAAATACTATGCTATATCCT CTTCTTATATTACTGCTTTTTACTTTGTTCATTGGATCCATAGGAATCCATTTTGATAATGGAGTAAAGGATAATGGAAT ATCGGAGTTAACCATATTATCAAGGTGGCTAACTCCTTCTATAAACTTTTTCCAGGAAAGTTCTAATTCTTCCATAAATT CCTATGAATTTATCACTAATGCAATTTCTTCTGTAAGTTTAGCAATTTTGGGTCTATTCATAGCATATATCTTCTATGGA TCCGCTTATTATTTTTTTCAGAATTTGAATTTCCAAAATTCCCTTGTAAAAATAAAAAAGAATCCAAAAAAGAACTTTTT GGA TGAAGTAAAAAAAAAGATATACAGCTGGTCATATAATCGTGGTTATATGGATGTTTTCTATACTAGGGTAT TTATCCTGGGTATAAGAAGATTAGCAGAACTAACACATTTTTTCGATAAAGGTGTCATTGATGGAATTACCAATGGAGTG Paspalum conspersum ATGTCAATGGGATTTGGACTTTTTCTTATTCCGACAGCAACAAAAAATCTTCGTCGCATATGGGCTTTTCCTAGTATTTT ACTCTTAAGTATAGCTATGGTATACTCGGTTCACCTGTCTATTCAACAAATAAATGGAAGTTCTATCTATCAATATCTAT GGTCTTGGGCCATCAATAATGATTTTTCCTTAGAATTTGGATACTTGATCGACCCCCTTACGTCTATTATGTTAATACTA ATTACTACTGTAGGAATCTTGGTTCTTATTTATAGTGACGATTATATGTCTCACGATGAAGGATATTTGAGATTTTTTGT TTATATAAGTTTTTTTAATACTTCCATGTTGGGATTGGTTACTAGTTCCAATTTGATACAAATTTATTTTTTTTGGGAAC TTATCGGAATGTGTTCCTATTTATTGATAGGCTTTTGGTTTACACGGCCAATTGCAGCGAGTGCTTGTCSAAAANCTTTT GTAACTAATCGTGTAGGGGATTTTGGTCTTTTATTAGGAATTTTAGGTTTTTTTTGGATAACGGGTAGTTTAGAGTTTCG GGATTTGTTCAAAATAGCTAATAACTGGATTCCTAATAATGGGATTAATTCCTTACTTACTACTTTGTGTGCTTTTTTAT TATTCCTTGGTGCAGTTGCAAAATCTGCACAATTCCCTCTTCACGTATGGTTACCCGATGCTATGGAAGGACCCACTCCC ATTTCGGCTCTTATACACGCAGCAACTATGGTTGCCGCGGGGATTTTTCTTTTGGCTCGACTTCTTCCTCTTTTCATATC TCTACCCTTGATAATGAGTTTAATTTCTTTAGTAGGTACAATAACACTCTTCTTAGGAGCCACTTTAGCTCTTGCTC AGAGAGATATTAAAAGAAGTTTAGCCTATTCTACAATGTCTCAATTGGGTTATATGATGTTAGCTCTAGGTATAGGT TCTTATCAAGCTGCTTTATTCCATTTGATCACTCATGCTTATTCGAAAGCTTTATTGTTCTTAGGATCGGGATCCATTAT TCATTCAATGGAACCTCTTGTTGGATATTCACCAGATAAAAGTCAGAATATGGTTCTTATGGGCGGTTTAAGAAAATACA TTCCAATTACAAGAACTACTTTTTTATGTGGTACACTTTCTCTTTGTGGTATTCCACCTCTTGCTTGCTTCTGGTCCAAA GATGAAATCCTTAGTAATAGTTGGTTGTATTCACCCTTTTTTGGAATTATAGCCTCTTTTACTGCAGGATTAACAGCATT TTATATGTTTCGGATATATTTACTTNCTTTTGATGGGTATTTGCGTGTTCATTTTCAAAATTACAGCAGTACTAAAGAAG GTTCGTTGTATTCAATATCCTTATGGGGAAAAGGTATATCCAAAGGAGTCAATAGGGAGTTTGTTTTATCAACAACGAAG AGTGGAGTTTCTTTTTTTTCACAAAATATACC TAAAATTCCTCGTAATACAAGAAATCAGAAGGGATCCTTTAG TGCTCCC TTTGGGGCTAAAAACACTTTTGTCTATCCACATGAAACGGGAAATACTATGCTATATCCTCTTCTTA TATTACTGCTTTTTACTTTGTTCATTGGATCCATGGGAATCCATTTTGATAATGGAGTAAAGGATAATGGAATATCGGAG TTAACCATATTATCAAGGTGGCTAACTCCTTCTATAAACTTTTTCCAGGAAAGTTCTAATTCTTCCATAAATTCCTATGA ATTTATCACTAATGCAATTTCTTCTGTAAGTTTAGCAATTTTGGGTCTATTCATAGCATATATNTTCTATGGATCCTCTT ATTATTTTTTTCAGAATTTGAATTTCCAAAATTCCCTTGTAAAAATAAAAAAGAATCCAAAAAAGAACTTTTTGGA TGAAGTAAAAAAAAAGATATACAGCTGGTCATATAATCGTGGTTATATGGATGTTTTCTATACTAGGGTATTTATCCT GGGTATAAGAAGATTAGCAGAACTAACACATTTTTTCGATAAAGGTGTCATTGATGGAATTATCAATGGAGTG Paspalum paniculatum ATGTCAATGGGATTTGGACTTTTTCTTATTCCGACAGCAACAAAAAATCTTCGTCGCATATGGGCTTTTCCTAGTATTTT ACTCTTAAGTATAGCTATGGTATACTCGGTTCACCTGTCTATTCAACAAATAAATGGAAGTTCTATCTATCAATATCTAT GGTCTTGGGCCATCAATAATGATTTTTCCTTAGAATTTGGATACTTGATCGACCCCCTTACGTCTATTATGTTAATACTA ATTACTACTGTAGGAATCTTGGTTCTTATTTATAGTGACGATTATATGTCTCACGATGAAGGATATTTGAGATTTTTTGTTTATATAAGTTTTTTTAAT ACTTCCATGTTGGGATTGGTTACTAGTTCCAATTTGATACAAATTTATTTTTTTTGGGAACTTATCGGAATGTGTTCCTA TTTATTGATAGGCTTTTGGTTTACACGGCCAATTGCAGCGAGTGCTTGTCAAAAAGCTTYYGTAAMTAATCGTTTAGGGG ATTTTGGTCTTTTATTAGGAATTTTAGGTTTTTTTTGGATAACGGGTAGTTTAGAGTTTCGGGATTTGTTCAAAATAGCT AATAACTGGATTCCTAATAATGGGATTAATTCCTTACTTACTACTTTGTGTGCTTTTTTATTATTCCTTGGTGCAGTTGC AAAATCTGCACAATTCCCTCTTCACGTATGGTTACCCGATGCTATGGAAGGACCCACTCCCATTTCGGCTCTTATACACG CAGCAACTATGGTTGCCGCGGGGATTTTTCTTTTGGCTCGACTTCTTCCTCTTTTCATATCTCTACCCTTGATAATGAGT TTAATTTCTTTAGTAGGTACAATAACACTCTTCTTAGGAGCCACTTTAGCTCTTGCTC AGAGAGATATTAAAAA AAKTTTAGCCTATTCTACAATGTCTCAATTGGGTTATATGATGTTAGCTCTAGGTATAGGTTCTTATCAAGCTGCTTTAT TCCATTTGATCACTCATGCTTATTCGAAAGCTTTATTGTTCTTAGGATCGGGATCCATTATTCATTCAATGGAACCTCTT GTTGGATATTCACCAGATAAAAGTCAGAATATGGTTCTTATGGGCGGTTTAAGAAAATACATTCCAATTACAAGAACTAC TTTTTTATGTGGTACACTTTCTCTTTGTGGTATTCCACCTCTTGCTTGCTTCTGGTCCAAAGATGAAATCCTTAGTAATA GTTGGTTGTATTCACCCTTTTTTGGAATTATAGCCTCTTTTACTGCAGGATTAACTGCATTTTATATGTTTCGGATATAT TTACTTACTTTTGATGGGTATTTGCGTGTTCATTTTCAAAATTACAGCAGTACTAAAGAAGGTTCGTTGTATTCAATATC CTTATGGGGAAAAGGTATATCCAAAGGAGTCAATAGGGAGTTTGTTTTATCAACAACGAAGAGTGGAGTTTCTTTTTTTT CACAAAATATACC TAAAATTCCTCGTAATACAAGAAATCAGAAGGGATCCTTTAGTGCTCCC TTTGGG GCTAAAAACACTTTTGTCTATCCACATGAAACGGGAAATACTATGCTATATCCTCTTCTTATATTACTGCTTTTTACTTT GTTCATTGGATCCATGGGAATCCATTTTGATAATGGAGTAAAGGATAATGGAATATCGGAGTTAACCATATTATCAAGGT GGCTAACTCCTTCTATAAACTTTTTCCAGGAAAGTTCTAATTCTTCCATAAATTCCTATGAATTTCTCACTAATGCAATT TCTTCTGTAAGTTTAGCAATTTNGGGTCTATTCATAGCATATATCTTCTATGGATCCTCTTATTATTTTTTTCAGAATTT GAATTTCCAAAATTCCCTTGTAAAAATAAAAAAGAATCCAAAAAAGAACTTTTTGGA TGAAGTAAAAAAAAAGA TATACAGCTGGTCATATAATCGTGGTTATATGGATGGTTTCTATACTAGGGTATTTATCCTGGGTATAAGAAGAWTAGCA GAACTAACACATTTTTTCGATAAAGGTGTCATTGATGGAATTATCAATGGAGTG Paspalum remotum ATGTCACTGGGATTTGGACTTTTTCTTATTCCGACAGCAACAAAAAATCTTCGTCGCATATGGGCTTTTCCTAGTATTTT ACTCTTAAGTATAGCTATGGTATACTCGGTTCACCTGTCTATTCAACAAATAAATGGAAGTTCTATCTATCAATATCTAT GGTCTTGGGCCATCAATAATGATTTTTCCTTAGAATTTGGATACTTGATCGACCCCCTTACGTCTATTATGTTAATACTA ATTACTACTGTAGGAATCTTGGTTCTTATTTATAGTGACGATTATATGTCTCACGATGAAGGATATTTGAGATTTTTTGT TTATATAAGTTTTTTTAATACTTCCATGTTGGGATTGGTTACTAGTTCCAATTTGATACAAATTTATTTTTTTTGGGAAC TTATCGGAATGTGTTCCTATTTATTGATAGGCTTTTGGTTTACACGGCCAATTGCAGCGAGTGCTTGTCAAAAAGCTTTT GTAACTAATCGTGTAGGGGATTTTGGTCTTTTATNAGGAATTTTAGGTTTTTTTTGGATAACGGGTAGTTTAAAGTTTCG GGATTTGTTCAAAATAGCTAATAACTGGATTCCTAATAATGGGATTAATTCCTTACTTACTACTTTGTGTGCTTTTTTAT TATTCCTTGGTGCAGTTGCAAAATCTGCACAATTCCCTCTTCACGTATGGTTACCCGATGCTATGGAAGGACCCACTCCC ATTTCGGCTCTTATACACGCAGCAACTATGGTTGCCGCGGGGATTTTTCTTTTGGCTCGACTTCTTCCTCTTTTCATATC TCTACCCTTGATAATGAGTTTAATTTCTTTAGTAGGTACAATAACACTCTTCTTAGGAGCCACTTTAGCTCTTGCTC AGAGAGATATTAAAANAAGTTTAGCCTATTCTACAATGTCTCAATTGGGTTATATGANGTTAGCTCTAGGTATAGGT TCTTATCAAGCTGCTTTATTCCATTTGATCACTCATGCTTATTCGAAAGCTTTATTGTTCTTAGGATCGGGATCCATTAT TCATTCAATGGAACCTCTTGTTGGATATTCACCAGATAAAAGTCAGAATATGGTTCTTATGGGCGGTTTAAGAAAATACA TTCCAATTACAAGAACTACTTTTTTATGTGGTACACTTTCTCTTTGTGGTATTCCACCTCTTGCTTGCTTCTGGTCCAAA GATGAAATCCTTAGTAATAGTTGGTTGTATTCACCCTTTTTTGGAATTATAGCCTCTTTTACTGCAGGATTAACNGCATT TTATATGTTTCGGATATATTTACTTACTTTTGATGGGTATTTGCGTGTTCATTTTCAAAATTACAGCAGTACTAAAGAAG GTTCGTTGTATTCAATATCCTTATGGGGAAAAGGTATATCCAAAGGAGTCAATAGGGAGTTTGTTTTATCAACAACGAAG AGTGGAGTTTCTTTTTTTTCACAAAATATACC TAAAATTCCTCGTAATACAAGAAATCAGAAGGGATCCTTTAG TGCTCCC TTTGGGGCTAAAAACACTTTTGTCTATCCACATGAAACGGGAAATACTATGCTATATCCTCTTCTTA TATTACTGCTTTTTACTTTGTTCATTGGATCCATGGGAATCCATTTTGATAATGGAGTAAAGGATAATGGAATATCGGAG TTAACCATATTATCAAGGTGGCTAACTCCTTCTATAAACTTTTTCCAGGAAAGTTCTAATTCTTCCATAAATTCCTANGA ATTTCTCACTAATGCAATTTCTTCTGTAAGTTTAGCAATTTTGGGTCTATTCATAGCATATATCTTCTATGGATCCTCTT ATTATTTTTTTCAGAATTTGAATTTCCAAAATTCCCTTGTAAAAATAAAAAAGAATCCAAAAAAGAACTTTTTGGA TGAAGTAAAAAAAAAGATATACAGCTGGTCATATAATCGTGGTTATATGGATGTTTTCTATACTAGGGTATTTATCCT GGGTATAAGAAGATTAGCAGAACTAACACATTTTTTCGATAAAGGTGTCATTGATGGAATTATCAATGGAGTG Paspalum conjugatum ATGTCAATGGGATTTGGACTTTTTCTTATTCCGACAGCAACAAAAAATCTTCGTCGCATATGGGCTTTTCCTAGTATTTT ACTCTTAAGTATAGCTATGGTATTCTCGGTTCACCTGTCTATTCAACAAATAAATGGAAGTTCTATCTATCAATATCTATGGTCTTGGGCCATCAATAATGATTTTTCCTTAGAATTTGGATACT TGATCGACCCCCTTACGTCTATTATGTTAATACTAATTACGACTGTAGGAATCTTGGTTCTTATTTATAGTGACGATTAT ATGTCTCACGATGAAGGATATTTGAGATTTTTTGTTTATATAAGTTTTTTTAATACTTCCATGTTGGGATTGGTTACTAG TTCCAATTTGATACAAATTTATTTTTTTTGGGAACTTATCGGAATGTGTTCCTATTTATTGATAGGCTTTTGGTTTACAC GGCCAATTGCAGCGAGTGCTTGTCAAAAAGCTTTTGTAACTAATNGTGTAGGGGATTTTGGTCTTTTATTAGGAATTTTA GGTTTTTTTTGGATAACGGGTAGTTTAGAGTTTCGGGATTTGTTCAAAATAGCTAATAACTGGATTCCTAATAATGGGAT TAATTCCTTACTTACTACTTTGTGTGCTTTTTTATTATTCCTTGGTGCAGTTGCAAAATCTGCACAATTCCCTCTTCACG TATGGTTACCCGATGCTATGGAAGGACCCACCCCCATTTCGGCTCTTATACACGCGGCAACTATGGTTGCCGCGGGGATT TTTCTTTTGGCTCGACTTCTTCCTCTTTTCATATCTCTACCCTTGATAATGAGTTTAATTTCTTTAGTAGGTACAATAAC ACTCTTCTTAGGAGCCACTTTAGCTCTTGCTC AGAGAGATATTAAAAGAAGTTTAGCCTATTCTACAATGTCTC AATTAGGTTATATGATGTTAGCTCTAGGTATAGGTTCTTATCAAGCTGCTTTATTCCATTTGATCACTCATGCTTATTCG AAAGCTTTATTGTTCTTAGGATCGGGATCCATTATTCATTCAATGGAACCTCTTGTTGGATATTCACCAGATAAAAGTCA GAATATGGTTCTTATGGGCGGTTTAAGAAAATACATTCCAATTACAAGAACTACTTTTTTATGTGGTACACTTTCTCTTT GTGGTATTCCACCTCTTGCTTGCTTCTGGTCCAAAGATGAAATCCTTAGTAATAGTTGGTTGTATTCACCCTTTTTTGGA ATTATAGCCTCTTTTACTGCAGGATTAACTGCATTTTATATGTTTCGGATATATTTACTTACTTTTGATGGGTATTTGCG TGTTCATTTTCAAAATTACAGCAGTACTAAAGAAGGTTCGTTGTATTCAATATCCTTATGGGGAAAAGGTATATCCAAAG GAGTCAATAGGGATTTTGTTTTATCAACAACGAAGAGTGGAGTTTCTTTTTTTTCACAAAATATACC TCAAATT CCTCGTAATACAAGAAATCAGAAGGGATCCTTTAGTGCTCCC TTTGGGGCTAAAAACACTTTTGTCTATCCACA TGAAACGGGAAATACTATGCTATATCCTCTTCTTATATTACTGCTTTTTACTTTGTTCATTGGATCCCTGGGAATCCATT TTGATAATGGAGTAAAGGATAATGAAATATCGGAGTTAACCATATTATCAAGGTGGCTAACTCCTTCTATAAACTTTTTC CAGGAAAGTTCTAATTCTTCCATAAATTCCTATGAATTTCTCANTAATGCAATTTCTTCTGTAAGTTTAGNTATTTTGGG TNTATTCATAGCANATATTTTTTATGGATCCGCTTATTATTTTTTTCAGAATTTGAATTTCCAAAATTCCCTTGTAAAAA TAAAAAAAAATCCAAAAAAGAACTTTTTGGA TGAANTNAAAAAAAAGATATACAGCTGGTCATATAATCGTGGT TATATGGATNTTTNCTATACTAGGGTATTTATCCTGGGTATAAAAAAATTANCAAAACTAACACNTTTTTTCNATAAAGG TNTCATTGATGGAATTACCAATGGANTG Paspalum wettsteinii ATGTCAATGGGATTTGGACTTTTTCTTATTCCGACAGCAACAAAAAATCTTCGTCGCATATGGGCTTTTCCTAGTATTTT ACTCTTAAGTATAGCTATGGTATACTCGGTTCACCTGTCTATTCAACAAATAAATGGAAGTTCTATCTATCAATATCTAT GGTCTTGGGCCATCAATAATGATTTTTCCTTAGAATTTGGATACTTGATCGACCCCCTTACGTCTATTATGTTAATACTA ATTACTACTGTAGGAATCTTGGTTCTTATTTATAGTGACGATTATATGTCTCACGATGAAGGATATTTGAGATTTTTTGT TTATATAAGTTTTTTTAATACTTCCATGTTGGGATTGGTTACTAGTTCCAATTTGATACAAATTTATTTTTTTTGGGAAC TTATCGGAATGTGTTCCTATTTATTGATAGGCTTTTGGTTTACACGGCCAATTGCAGCGAGTGCTTGTCAAAAAGCTTTT GTAACTAATCGTGTAGGGGATTTTGGTCTTTTATTAGGAATTTTAGGTTTTTTTTGGATAACGGGTAGTTTAGAGTTTCG GGATTTGTTCAAAATAGCTAATAACTGGATTCCTAATAATGGGATTAATTCCTTACTTACTACTTTGTGTGCTTTTTTAT TATTCCTTGGTGCAGTTGCAAAATCTGCACAATTCCCTCTTCACGTATGGTTACCCGATGCTATGGAAGGACCCACTCCC ATTTCGGCTCTTATACACGCAGCAACCATGGTTGCCGCGGGGATTTTTCTTTTGGCTCGACTTCTTCCTCTTTTCATATC TCTACCCTTGATAATGAGTTTAATTTCTTTAGTAGGTACAATAACACTCTTCTTAGGGGCCACTTTAGCTCTTGCTC AGAGAGATATTAAAAGAAGTTTAGCCTATTCTACAATGTCTCAATTGGGTTATATGATGTTAGCTYTAGGTATAGGT TCTTATCAAGCTGCTTTATTCCATTTGATCACTCATGCTTATTCGAAAGCTTTATTGTTCTTAGGATCGGGATCCATTAT TCATTCAATGGAACCTCTTGTTGGATATTCACCAGATAAAAGTCAGAATATGGTTCTTATGGGCGGTTTAAGAAAATACA TTCCAATTACAAGAACTACTTTTTTATGTGGTACACTTTCTCTTTGTGGTATTCCACCTCTTGCTTGCTTCTGGTCCAAA GATGAAATCCTTAGTAATAGTTGGTTGTATTCACCCTTTTTTGGAATTATAGCCTCTTTTACTGCAGGATTAACTGCATT TTATATGTTTCGGATATATTTACTTACTTTTGATGGGTATTTGCGTGTTCATTTTCAAAATTACAGCAGTACTAAAGAAG GTTCGTTGTATTCAATATCCTTATGGGGAAAAGGTATATCCAAAGGAGTCAATAGGGAGTTTGTTTTATCAACAACGAAG AGTGGAGTTTCTTTTTTTTCACAAAATATACC TAAAATTCCTCGTAATAGAAGAAATCAGAAGGGATCCTTTAG TGCTCCC TTTGGGGCTAAAAACACTTTTGTCTATCCACATGAAACGGGAAATACTATGCTATATCCTCTTCTTA TATTACTGCTTTTTACTTTGTTCATTGGATCCATGGGAATCCATTTTGATAATGGAGTAAAGGATAATGGAATATCGGAG TTAACCATATTATCAAGGTGGCTAACTCCTTCTATAAACTTTTTCCAGGAAAGTTCTAATTCTTCCATAAATTCCTATGA ATTTCTCACTAATGCAATTTCTTCTGTAAGTTTAGCAATTTTGGGTCTATTCATAGCATATATCTTCTATGGATCCGCTT ATTATTTTTTTCAGAATTTGAATTTCCAAAATTCCCTTGTAAAAATAAAAAAGAATCCAAAAAAGAACTTTTTGGA TGAAGTAAAAAAAAAGATATACAGCTGGTCATATAATCGTGGTTATATGGATGTTTTCTATACTAGGGTATTTATCCT GGGTATAAGAAGATTAGCGGAACTAACACATTTTTTCGATAAAGGTGTCATTGATGGAATTATCAATGGAGTG Paspalum malacophyllum ATGTCNATGGGATTTGGACTTTTTCTTATTCCGACAGCAACAAAAAATCTTCGTCGCATATGGGCTTTTCCTAGTATTTT ACTCTTAAGTATAGCTATGGTATACTCGGTTCACCTGTCTATTCAACAAATAAATGGAAGTTCTATCTATCAATATCTAT GGTCTTGGGCCATCAATAATGATTTTTCCTTAGAATTTGGATACTTGATCGACCCCCTTACGTCTATTATGTTAATACTA ATTACTACTGTAGGAATCTTGGTTCTTATTTATAGTGACGATTATATGTCTCACGATGAAGGATATTTGAGATTTTTTGT TTATATAAGTTTTTTTAATACTTCCATGTTGGGATTGGTTACTAGTTCCAATTTGATACAAATTTATTTTTTTTGGGAAC TTATCGGAATGTGTTCCTATTTATTGATAGGCTTTTGGTTTACACGGCCAATTGCAGCGAGTGCTTGTCAAAAAGCTTTN GTAANTAATCGTGTGGNGGATTTTGGTCTTTTANTAGGAATTTTAGGTNNTTTTTGGATAACGGGTAGTTTAGAGTTTCG GGATTTGTTCAAAATAGCTAATAACTGGATTCCTAATAATGGGATTAATTCCTTACTTACTACTTTGTGTGCTTTTTTAT TATTCCTTGGTGCAGTTGCAAAATCTGCACAATTCCCTCTTCACGTATGGTTACCCGATGCTATGGAAGGACCCACTCCC ATTTCGGCTCTTATACACGCAGCAACTATGGTTGCCGCGGGGATTTTTCTTTTGGCTCGACTTCTTCCTCTTTTCATATC TCTACCCTTGATAATGAGTTTAATTTCTTTAGTAGGTACAATAACACTCTTCTTAGGAGCCACTTTAGCTCTTGCTC AGAGAGATATTAAAAGAAGTTTAGCCTATTCTACAATGTCTCAATTGGGTTATATGATGTTAGCTCTAGGTATAGGT TCTTATCAAGCTGCTTTATTCCATTTGATCACTCATGCTTATTCGAAAGCTTTATTGTTCTTAGGATCGGGATCCATTAT TCATTCAATGGAACCTCTTGTTGGATATTCACCAGATAAAAGTCAGAATATGGTTCTTATGGGCGGTTTAAGAAAATACA TTCCAATTACAAGAACTACTTTTTTATGTGGTACACTTTCTCTTTGTGGTATTCCACCTCTTGCTTGCTTCTGGTCCAAA GATGAAATCCTTAGTAATAGTTGGTTGTATTCACCCTTTTTTGGAATTATAGCCTCTTTTACTGCAGGATTAACNGCATT TTATATGTTTCGGATATATTTACTTACTTTTGATGGGTATTTGCGTGTTCATTTTCAAAATTACAGCAGTACTAAAGAAG GTTCGTTGTATTCAATATCCTTATGGGGAAAAGGTATATCCAAAGGAGTCAATAGGGAGTTTGTTTTATCAACAACGAAG AGTGGAGTTTCTTTTTTTTCACAAAATATACC TAAAATTCCTCGTAATACAAGAAATCAGAAGGGATCCTTTAG TGCTCCC TTTGGGGCTAAAAACACTTTTGTCTATCCACATGAAACGGGAAATACTATGCTATATCCTCTTCTTA TATTACTGCTTTTNACTTTGTTCATTGGATCCATGGGAATCCATTTTGATAATGGAGTAAAGGATAATGGAATATCGGAG TTAACCATATTATCAAGGTGGCTAACTCCTTCTATAAACTTTTTCCAGGAAAGTTCTAATTCTTCCATAAATTCCTANGA ATTTCTCACTAATGCAATTTCTTCTGTAAGNTTAGCAATTNNGGGTCTATTCATAGCATATATCTTCTATGGATCCGCTT ATTATTTTTTTCAGAATTTGAATTTCCAAAATTCCCTTGTAAAAATAAAAAAGAATCCAAAAAAGAACTTTTTGGA TGAAGTAAAAAAAAAGATATACAGCTGGTCATATAATCGTGGTTATATGGATGTTTTCTATACTAGGGTATTTATCCT GGGTATAAGAAGATTAGCAGAACTAACACATTTTTTCGATAAAGGTGTCATTGATGGAATTATCAATGGATTG Pennisetum alopecuroides ATGTCAATGGGATTTGGACTTTTTCTTATTCCGACAGCAACAAAAAATCTTCGTCGCATATGGGCTTTTCCTAGTATTTT ACTCTTAAGTATAGCTCTGGTATTCTCAGTTCACCTGTCTATTCAACAAATAAATGGAAGTTCTATCTATCAATATCTAT GGTCTTGGACCATCAATAACGATTTTTCTTTAGAATTTGGATACTTGATCGACCCCCTTACGTCTATTATGTTAATACTA ATTACTACTGTAGGAATCTTGGTTCTTATTTATAGTGACGATTATATGTCTCACGATGAAGGATATTTGAGATTTTTTGT TTATATAAGTTTTTTTAATACTTCCATGTTGGGATTGGTTACTAGTTCCAATTTGATACAAATTTATTTTTTTTGGGAAC TTGTCGGAATGTGTTCCTATTTATTGATAGGCTTTTGGTTTACACGGCCAATTGCAGCGAGTGCTTGCCAAAAAGCTTTT GTAACTAATCGTGTAGGGGATTTTGGTCTGTTATTAGGAATTTTAGGTTTTTTTTGGATAACAGGTAGTTTAGAGTTTCG GGATTTGTTCAAAATAGCTAATAACTGGATTCCTAATAATGGGATTAATTCCTTACTTACTACTTTGTGTGCTTTTTTAT TATTCCTTGGTGCAGTTGCAAAATCCGCACAATTCCCTCTTCACGTATGGTTACCCGATGCTATGGAAGGACCCACTCCC ATTTCGGCTCTTATACACGCAGCAACTATGGTTGCTGCGGGGATTTTTCTTCTAGCTCGACTTCTTCCTCTTTTCATATC TCTACCCTTGATAATGAGTTTTATTTCTTTAGTAGGTACAATAACACTCTTCTTAGGAGCCACTTTAGCTCTTGCTC AGAGAGATATTAAAAGAAGCTTAGCCTATTCTACAATGTCTCAATTGGGTTATATGATGTTAGCTCTCGGTATAGGT TCTTATGAAGCTGCTTTATTCCATTTGATCACTCATGCTTATTCGAAAGCTTTATTGTTCTTAGGATCCGGATCCGTTAT TCATTCAATGGAACCTCTTGTTGGATATTCACCAGATAAAAGTCAGAATATGGTTCTTATGGGTGGTTTAAGAAAATACG TTCCAATTACAAGAACTACTTTTTTATGTGGTACACTTTCTCTTTGTGGTATTCCACCTCTTGCTTGCTTCTGGTCCAAA GATGAAATCCTTAGTAATAGCTGGTTGTATTCACCTTTTTTTGGAATAATAGCCTCTTTTACTGCAGGATTAACAGCATT TTATATGTTTCGGATATAAAAACAAACTCTTGATNGGCATTTGCGTGTTCATTTTCGGCATTACAGGAGTANTAAAGAAG GTTCGTTGTATTCAATATCCTTATGGGGAAAAGGTATATCCAAAGGAGTCAATAGAGATTTTGTTTTATCAACAATGAAG GATGGAGTTTCTTTTTTTTCACAAAATATCCC TCAAATTCCTGGTAATACAAGAAATAAGATAGGATCCTTTAG TACTCCT TTTGGGGCTAAAAACACTTTTGTCTATCCTCATGAAACGGGAAATACTATGCTATTTCCTCTTCTTA TATTACTGCTTTTTACTTTGTTCATTGGATCCATAGGAATCCATTTTGATAATGGAATAAAGGGTAATGGAATATCGGAG TTAACCATATTATCAAAGTGGCTAACTCCTTCAATAAACTCTTTCCAGGAAAGTTCTAATTCTTCCATAAATTCATATGA ATTTCTCATTAATGCAATTTATTCTGTAAGTTTAGCAATTCTGGGTCTATTCATAGCATATATCTTCTATGGATCTACTT ATTCTTTTTTTCAGAATTTGAATTTTCTAAATTCCCTTGT TAAAGGGAATCCAAAAAAAAACTTTNTGGA TCAAGTAAAAGAAAAGATATACAGCTGGTC Pennisetum setaceum ATGTCAATGGGATTTGGACTTTTTCTTATTCNGACAGCAACAAAAAATCTTCGTCGCATATGGGCTTTTCCTAGTATTGG ACTCTTAAGTATAGCTCTGGTATTCTCAGTTCACCTGTCTATTCAACAAATAAATGGAAGTTCTATCTATCAATATCTAT GGTCTTGGACCATCAATAACGATTTTTCTTTAGAATTTGGATACTTGATCGACCCCCTTACGTCTATTATGTTAATACTA ATAACTACTGTAGGAATCTTGGTTCTTATTTATAGTGACGATTATATGTCTCACGATGAAGGATATTTGAGATTTTTTGT TTATATAAGTTTTTTTAATACTGCCATGTTGGGATTGGTTACTAGTTCCAATTTGATACAAATTTATTTTTTTTGGGAAC TTGTCGGAATGTGTTCCTATTTATTGATAGGCTTTTGGTTTACACGGCCAATTGCAGCGAGTGCTTGCCAAAAANCTTTT GTAACTAATCNTGTNTGGGATTTTGGTCTGTTATTAAGA TTTTAG TTTTTTTTGGATAACAGGTAGTTTAGAGTTTCG GGATTTGTTCAAAATAGCTAATAACTGGATTCCTAATAATGGGATTAATTCCTTACTTACTACTTTGTGTGCTTTTTTAT TATTCCTTGGTGCAGTTGCAAAATCCGCACAATTCCCTCTTCACGTATGGTTACCCGATGCTATGGAAGGACCCACTCCC ATTTCGGCTCTTATACACGCAGCAACTATGGTTGCTGCGGGGATTTTTCTTCTAGCTCGACTTCTTCCTCTTTTCATATC CCTACCCTGGATAATGAGTTTTATTTCTTTAGTAGGTACAATAACACTCTTTTTAGGAGCCACTTTAGCTCTTGCTC AGAGAGATATTAAAAGAAGCTTANCCTATTCNACAATGTCTCAATTGGGTTATATGATGTTAGCTCTCGGTATAGGT TCTTATGAAGCTGCTTTATTCCATTTGATCACTCATGCTTATTCGAAAGCTTTATTGTTCTTAGGATCCGGATCCGTTAT TCATTCAATGGAACCTCTTGTTGGATATTCACCAGATAAAAGTCAGAATATGGTTCTTATGGGTGGTTTAAGAAAATACG TTCCAATTACAAGAACTACTTTTTTATGTGGTACACTCTCTCTTTGTGGTATTCCACCTCTTGCTTGCTTCTGGTCCAAA GATGAAATCCTTAGTAATAGCTGGTTGTATTCACCTTTTTTTGGAATAATACCCTCTTTTACTGCANGATTNACTGCNTT TTATATNTTTCGGATATATTTACTTACTTTTGATGGGTATTTGCGTGTTCATTTTCAAAATTACAGCAGTACTAAAGAAG GTTCGTTGTATTCAATATCCTTATGGGGAAAAGGCATATCCAAAGGAGTCAATAGAGATTTTGTTTTATCAACAATGAAG GATGGAGTTTCTTTTTTTTCACAAAATAGACC TCAAATTCCTGATAATACAAGAAATAAGATAGGATCCTTTAG TACTCCC TTTGGGGCTAAAAACACTTTTGTCTATCCTCATGAAACGGGAAATACTATGCTATTTCCTCTTCTTA TATTACTGCTTTTTACTTTGTTCATTGGATCCATAGGAATCCATTTTGATAATGGAATAAAGGGTAATGGAATATCAGAG TTAACCATATTATCAAAGTGGCTAACTCCTTCAATAAACTCTTTTCAGGAAAGTTCTAATTCTTCCATAAATTCATNTGA ATTTCTCATTAATGCAATTTCTTCTGTAAGTTTAGCAATTCTTGGTCTATTCATAGCATATATCTTCTATGGATCTACTT ATTCTTTTTTTCAGAATTTGAATTTTCTAAATTCCCTTGT AAAAGGGAATCCAAAAAAAAACTTTTTGGA TCAAGTAAAAGAAAAGATATACAGCTGGTCATATAATCGTGGTTATATANATGTTTTCTATACTAGGGTCTTTATCTT GGGTATAAGAANATTAGCCGAACTAACGAATTTTTTCGATAAGGGTGTTATCGATGGAATTACCAATGGAGTA Plagiantha tenella ATGTCAATGGGATTTGGACTTTTTCTTATTCCGACAGCAACAAAAAATCTTCGTCGCATATGGGCTTTTCCTAGTATTTT ACTCTTAAGTATAGCTATGGTATTCTCAGTTCACCTGTCTATTCAACAAATAAATGGAAGTTCTATCTATCAATATCTAT GGTCTTGGACCATCAATAATGATTTTTCCTTAGAATTTGGATACTTGATCGACCCCCTTACGTCTATTATGTTAATACTA ATTACTACTGTAGGAATCTTGGTTCTTATTTATAGTGACGATTATATGTCTCACGATGAAGGATATTTGAGATTTTTTGT TTATATAAGTTTTTTTAATACTTCCATGTTGGGATTGGTTACTAGTTCCAATTTGATACAAATTTATTTTTTTTGGGAAC TTATCGGAATGTGTTCCTATTTATTGATAGGCTTTTGGTTTACACGGCCAATTGCAGCAAGTGCTTGTCAAAAAGCTTTT GTAACTAATCGTGTAGGAGATTTTGGTCTGTTATTAGGAATTTTAGGTTTTTTTTGGATAACGGGTAGTTTAGAGTTTCG GGATTTGTTCAAAATAGCTAATAACTGGATCCCTAATAATGGGATTAATTCCTTACTTACTACTTTGTGTGCTTTTTTAT TATTCCTTGGTGCAGTTGCAAAATCTGCACAATTCCCTCTTCACGTATGGTTACCAGATGCTATGGAAGGACCCACTCCC ATTTCGGCTCTTATACACGCAGCAACTATGGTTGCCGCGGGGATTTTTCTTTTAGCTCGACTTCTTCCTCTTTTCATATC CCTACCCTTGATAATGAGTTTCATTTCTTTAGTAGGTACAATAACACTCTTCTTAGGAGCCACTTTAGCTCTTGCTC AGAGAGATATTAAAAGAAGTTTAGCCTATTCTACAATGTCTCAATTGGGTTATATGATGTTAGCTCTAGGTATAGGT TCTTATCAAGCTGCTTTATTCCATTTGATCACTCATGCTTATTCGAAAGCTTTATTGTTCTTAGGATCCGGATCCGTTAT TCATTCAATGGAACCTCTTGTTGGATATTCACCAGATAAAAGTCAGAATATGGTTCTTATGGGTGGTTTAAGAAAATACG TTCCAATTACAAGAACCACTTTTTTATGTGGTACACTTTCTCTTTGTGGTATTCCACCTCTTGCTTGCTTCTGGTCCAAA GATGAAATCCTTAGTAATAGTTGGTTGTATTCACCCTTTTTTGGAATAATAGCCTCTTTTACTGCAGGATTAACTGCATT TTATATGTTTCGGATATATTTACTTACTTTTGATGGGTATTTGCGTGTNAATTTTCAAAATTACAGCAGTACTAAAGAAG GTTCATTGTATTCAATATCTTTATGGGGAAAAAGTATATCCAAAAGAGTCAATAGGGATTTTGTTTTATCAACAAGGAAG AGCGGGGCTTCTTTTTTTTCACAAAATATACC TAAAATTCCTGGTAATACAAGAAATAAGATAGGATCCTTTAG TACTCCC TTTGGGGCTAAAAACACTTTTGTCTATCCTCATGAAACGGGAAATACTATGCTATATCCTCTTCTTA TATTACTGCTTTTNACTTTGTTCATTGGATCCATAGGAATCCATTTTGATAATGGGGTAAAGGATAATGGAATATCGGAG TTAACCGTATTATCAAAGTGGCTAACTCCTTCGATAAACTTTTTCCAGGAAAGTTCTAATTCTCCCATAAATTCCTATGA ATTTCTCACTAATGCAATTTCTTCTGTAAGTTTAGCAATTTTGGGTCTATTCATAGCANATATTTTCTATGGATCCGC ùTTATTATTTTTTTCAGAATTTGCATTTCAAAAATTCC ATAAAAAGGAATCCAAAAAAGAACTTTTTGGA TGAAGTAAAAAAAAAGATATACAACTGGTCATATAATCGTGGTTATATAGATTTTTTCTATACTAGGGTATTTATT CTGGGTATAAGAAGATTAGCAGAACTAACACATTTTTTCGATAAAGGTGTCATTGATGCAATTACCAATGGAGTA Melinis repens ATGTCAATGGGATTTGGACTTTTTCTTATTCCGACAGCAACAAAAAATCTTCGTCGTATATGGGCTTTTCCTAGTATTNT ACTCTTAAGTATAGCTCTGGTATTCTCAGTTCACCTGTCTATTCAACAAATAAATGGAAGTTCTATCTATCAATATCTAT GGTCTGGGACCATCAATAACGATTTTTCCTTAGAATTTGGATACTTGATCGACCCCCTTACGTCTATTATGTTAATACTA ATTACTACTGTAGGAATCTTGGTTCTTATTTATAGTGACGATTATATGTCTCACGATGAAGGATATTTGAGATTTTTTGT TTATATAAGTTTTTTTAATACTGCCATGTTGGGATTGGTTACTAGTTCCAATTTGATACAAATTTATTTTTTTTGGGAAC TTGTCGGAATGTGTTCCTATTTATTGATAGGCTTTTGGTTTACACGACCAATTGCAGCGAGTGCTGGCCAAAAAGCTTTT GTAACTAATCGTGTAGGGGATTTNGGTCTGTTATTAGGAATTTTAGGTTTTTTTTGGATAACGGGTAGTTTAGAGTTTCG TGATTTGTTCAAAATAGCTAATAACTGGATTCCTAATAATGGGATTAATTCCTTACTTACTACTTTGTGTGCTTTTTTAT TATTCCTTGGTGCAGTTGCAAAATCTGCACAATTCCCTCTTCACGTATGGTTACCCGATGCTATGGAAGGACCCACTCCC ATTTCGGCTCTTATACACGCAGCAACTATGGTTGCTGCAGGGATTTTTCTTATAGCTCGACTTCTTCCTCTTTTCATATC CCTACCTTTGATAATGAGTTTTATTTCTTTAGTAGGTACAATAACACTCTTCTTAGGAGCCACTTTAGCTCTTGCTC AGAGAGATATAAAAAGAAGCTTAGCCTATTCTACAATGTCTCAATTGGGTTATATGATGTTAGCTCTAGGTATAGGT TCTTATGAAGCTGCTTTATTCCATTTGATCACTCATGCTTATTCGAAAGCTTTATTGTTTTTAGGATCCGGATCCATTAT TCATTCAATGGAACCTCTTGTTGGATATTCACCAGATAAAAGTCAGAATATGGTTCTTATGGGTGGTTTAACAAAATACG TTCCAATTACAAGAACTACTTTTTTATGTGGTACACTTTCTCTTTGTGGCATTCCACCTCTTGCTTGCTTCTGGTCCAAA GATGAAATTCTTAGTAATAGTTGGTTATATTCACCCTTTTTTGGAATAATAGCCTCTTTTACTGCAGGATTAACAGCATT TTATATGTTTCGNNNNNNNNN GNGTTCATTTTCAAAATTACAGCAGTACTAAAGAAG GTTCGTTGTATTCAATATCCTTATGGGGAAAAGGCATATCTAAAGGAGTCAATAGGGATTTTGTTTTATCAACAATGAAG GGTGGAGTTTCTTTTTTTTCACAAAATATACC CAAAATTCCCGATAATACAAGAAATAAGATAGGATCCTTTAG TACTCCT TTTGGGGCTAAAAACACTTTTGTCTATCCTCATGAAACGGGAAATACTATGTTATTTCCTCTTCTTA TATTACTGCTTTTTACTTTGTTCATTGGATCTATAGGAATCCATTTTGATAATGGAATAAAGGGTAATGGAATATCGGAG TTAACCATATTATCAAAGTGGCTAACTCCTTCAATAAACTTTTTCCGGGAAAGTTCTAATTCTTCCATAAATTCATATGA ATTTATCATTAATGCAATTTCTTCTGTAAGTTTAGCAATTCTNGGTCTATTCATAGCATATATNTTCTATGGATCCACTT ATTCTTTTTTTCTGAATTTAAATTTGCAAAATTCCCTTGT AAAAGGGAACCCAAAAAAGAACTTTTGGGA TGAAGTAAAAGAAAAGATATATAGCTGGTCATATAATCGCGGTTATATAGATATTCTATATACTAGGGTTTTTATCCT GGGTATAAGAAGATTAGCTGAACTATCAAATTTTTTCGATAAGGGTGTCATTGATGGTATTATCAATGGAGTA Pseudechinolaena polystachya ATGTCAATGGGATTTGGACTTTTTCTTATTCCGACAGCAACAAAAAATCTTCGTCGCATATGGGCTTTTCCTAGTATTTT ACTCTTAAGTATAGCTCTGGTATTCTCGGTTCACCTGTCTATTCAACAAATAAATGGAAGTTCTATCTATCAATATCTAT GGTCTTGGACCATCAATAATGATTTTTCCTTAGAATTTGGATACTTGATCGACCCCCTTACGTCTATTATGTTAATACTA ATTACTACTGTAGGAATCTTGGTTCTTATTTATAGTGACGATTATATGTCTCACGATGAAGGGTATTTGAGATTTTTTGT TTATATAAGTTTTTTTAATACTGCCATGTTGGGGTTGGTTACTAGTTCCAATTTGATACAAATTTATTTTTTTTGGGAAC TTGTCGGAATGTGTTCCTATTTATTGATAGGCTTTTGGTTTACACGGCCGATTGCAGCGAGTGCTTGCCAAAAAGCTTTT GTAACTAATCGTGTAGGGGATTTTGGTCTGTTATTAGGAATTTTAGGTTTTTTTTGGATAACGGGTAGTTTAAAGTTTCG GGATTTGTTCAAAATAGCTACTAACTGGATTCCTAATAATGGGATTAATTCCTTACTTACTACTTTGTGTGCTTTTTTAT TATTCCTTGGTGCAGTTGCTAAATCTGCACAATTTCCTCTTCACGTATGGTTACCCGATGCTATGGAAGGACCCACTCCC ATTTCGGCTCTTATACACGCAGCAACTATGGTTGCTGCGGGGATTTTTCTTCTAGCTCGACTTCTTCCTCTTTTCATATC CCTACCCTTGATAATGAGTTTTATTTCTTTAGTAGGTACAATAACACTCTTCTTAGGAGCTACTTTANCTCTTGCTC AAANANATATTAAAANAANCTTANCCTATNCTACAATGTCTCAATTGGGTTATATGATGTTAGCCCTAGGTATAGGC TCTTATCAAGCTGCTTTATTCCATTTGATCACTCATGCTTATTCGAAAGCTTTATTGTTCTTAGGATCCGGATCCGTTAT TCATTCAATGGAACCTCTTGTTGGATATTCACCAGATAAAAGTCAGAATATGGTTCTTATGGGTGGTTTAAGAAAATATG TTCCAATTACAAGAACTACTTTTTTATGTGGTACACTTTCTCTTTGTGGTATTCCACCTCTTGCTTGCTTCTGGTCCAAA GATGAAATCCTTAATAATAGTTGGTTATATTCACCCTTTTTTGGAATAATAGCGTCTTTTACTGCAGGATTAACAGCATT TTATATGTTTCGGATATATNTACTTACTTTTGATGGATATTTGCGTGTTCATTTTCAAAATTACAGCAGTACTAAAGAGG GTTCGTTGTATTCAATATCTTTATGGGGAAAAGGCATATCCAAAGGAGTCAATAGGGATTTTGTTTTATCAACAATGAAG AGTGGAGTTTCTTTTTTTTCACAAAATATACC CAAAATTCCTGGTAATACAAGAAATAAGATAGGATCCTTTAG TACTCCC TTTGGGGCTAAAAGCACTTTTGTCTATCCTCATGAAACAGGAAATACTATGCTATTTCCTCTTCTTT TATTACTACTTTTTACTTTGTTCATTGGATCCATAGGAATCCATTTTGATAATGGAATAAAGGGTAATGGAATATCGGAG TTAACCATATTATCAAAGTGGCTAACTCCTTCAATAAACTTTTTCCAGGAAAGTTCTAATTCTTCCATAAATTCATATGAATTTCTCACTAATGTAATTTCTTC TGTAAGTTTAGCTATTTTTGGTCTATTCATAGCATATATCTTCTATGGATCTACTTATTCTTTTTTTCAGAATTTGAATT TTATAAATTCCCTTGT AAAAGGGAATCCAAAAAAGAACTTTTTGGA TGAAGTAAAAAAAAANATATAC AGCTGGTCCTATAATCGTGGTTATATAAATGTTTTCTATACTAGGGTTTTTATCTTGGGTATAAAAAAATTANCCGAACT AACGCATTTTTTCNATAAAGGTGTCATTGATGGAATTACCAATGGANTA Sacciolepis indica ANGTCAATGGGATTTGGACTTTTTCTTATTCCGACAGCAACAAAAAATCTTCGTCGCATATGGGCTTTTCCTAGTATTTT ACTCTTAAGTATAGCTCTGATATTCTCAGTTCACCTGTCTATTCAACAAATAAATGGAAGTTCTATCTATCAATATCTAT GGTCTTGGACCATCAATAATGATTTTTCCTTAGAATTTGGATACTTGATCGACCCCCTTACGTCTATTATGTTAATACTA ATTACTACTGTAGGAATCTTGGTTCTTATTTATAGTGACGATTATATGTCTCACGATGAAGGATATTTGAGATTTTTTGT TTATATAAGTTTTTTTAATACTGCCATGTTGGGATTGGTTACTAGTTCCAATTTGATACAAATTTATTTTTTTTGGGAAC TTGTCGGAATGTGTTCCTATTTATTGATAGGCTTKTGGTTTACACGGCCAATTGCAGAGAGNNNNNNNNNNNNN ATTTTGGTTTGTTATTAGGAATTTTAGGTTTTTTTTGGATAACGGGTAGTTTAGAGTTTCG GGATTTGTTCAAAATAGCTAATAATTGGATTCCTAATAATGGTATTAATTCCTTACTTACTACTTTGTGTGCTTTTTTAT TATTCCTTGGTGCAGTTGCAAAATCTGCACAATTCCCTCTTCACGTATGGTTACCCGATGCCATGGAAGGACCCACTCCC ATTTCGGCTCTTATACACGCAGCAACTATGGTTGCTGCGGGGATTTTTCTTTTAGCTCGACTTCTTCCTCTTTTCATATC CCTACCCTTGATAATGAGTTTTATTTCTTTAGTAGGTACAATAACACTCTTCTTAGGAGCCACTTTAGCTCTTGCTC AGAGAGATATTAAAAAAAGCTTAGCCTATTCTACAATGTCTCAATTGGGTTATATGATGTTAGCTCTAGGTATAGGT TCTTATCAAGCTGCTTTATTCCATTTGATCACTCATGCTTATTCGAAAGCTTTATTGTTCTTAGGATCCGGATCCGTTAT TCATTCAATGGAACCTCTTGTTGGATATTCACCAGATAAAAGTCAGAATATGGTTCTTATGGGTGGTTTAAGAAAATACG TTCCAATTACAAGAAGTACTTTTTTATGTGGTACACTTTCTCTTTGTGGTATTCCACCTCTTGCTTGCTTCTGGTCCAAA GATGAAATCCTTAGTAATAGTTGGTTGTATTCACCCTTTTTTGGAATAATAGCCTCTTTTACTGCAGGATTAACTGCATT TTATATGTTTCGGATATATTTACTTACTTTTGATGGGTATTTGCGTGTTCATTTTCAAAATTACAGCAGTACTAAAGAGG GTTCGTTGTATTCAATATCCTTATGGGGAAAAGGCATATCCAAAGGAGTCAATAGGGATTTTGTTTTATCAACAATGAAG AGTGGGGTTTCTTTTTTTTCACAAAATATACC CAAAATTCCTGGTAATACAAGAAATAAGATAGGATCCTTTAG TACTCCC TTTGTGGCTAAAAACACTTTTGTCTATCCTCATGAAACGGGAAATACTATGCTATTTCCTCTTCTTA TATTACTGCTTTTTACTTTGTTCATTGGATCTATAGGAATCCATTTTGATAATGGAATAAAGGGCAATGGAATATCGGAG TTAACCATATTATCAAAGTGGATAACTCCTTCAATAAACTTTTTCCAGGAAAGTTCGAATTCTTCCATAAATTCATATGA ATTTCTCACTAATGCAATTTCTTCTGTAAGTTTAGCAATTTTGGGTCTATTCATAGCATATATNTTCTATGGATNTANTT ATTNTTTTTTTCAGAATTTGAATTTTNTAAATTCCCTTGT AAAAGGGAATCCAAAAAAGAACTTTTTGAA TGAAGTAAAAAAAAAGATATACAGCTGGTCATATAATCGTGGTTATATAGATGTTTTCTATACTAGGTTCTTTATCTT GGGTATAANAAAATTAGCTGAACTAACACATTTTTTTGATAAAGGTGTCATTGATGGAATTACCAATGGAGTA Setaria macrostachya ATGTCAATGGGATTTGGACTTTTTCTTATTCCGACAGCAACAAAAAATCTTCGTCGCATATGGGCTTTTCCTAGTATTTT ACTCTTAAGTATAGCTCTGGTATTCTCAGTTCACCTGTCTATTCAACAAATAAATGGAAGTTCTATCTATCAATATCTAT GGTCTTGGACCATCAATAACGATTTTTCTTTAGAATTTGGATACTTGATCGACCCCCTTACGTCTATTATGTTAATACTA ATTACTACTGTCGGAATCTTGGTTCTTATTTATAGTGACGATTATATGTCTCACGATGAAGGATATTTGAGATTTTTTGT TTATATAAGTTTTTTTAATACTGCCATGTTGGGATTGGTTACTAGTTCCAATTTGATACAAATTTATTTTTTTTGGGAAC TTGTCGGAATGTGTTCCTATTTATTGATAGGCTTTTGGTTTACACGGCCAATTGCAGCGAGTGCTTGCCAAAAAGCTTTT GTAACTAATCGTGTAGGAGATTTTGGTCTGTTATTAGGAATTTTAGGTTTTTTTTGGATAACGGGTAGTTTAGAGTTTCG GGATTTGTTCAAAATAGCTAATAACTGGATTCCTAATAATGGGATTAATTCTTTACTTACTACTTTGTGTGCTTTTTTAT TATTCCTTGGTGCCGTTGCAAAATCCGCACAATTCCCTCTTCACGTATGGTTACCCGATGCTATGGAAGGACCCACTCCC ATTTCGGCTCTTATACACGCAGCAACTATGGTTGCTGCGGGGATTTTTCTTCTAGCTCGACTTCTTCCTCTTTTTATATC CCTACCCTTAATAATGAGTTTTATTTCTTTAGTAGGTACAATAACACTCTTCTTAGGAGCCACTTTAGCTCTTGCTC AGAGAGATATTAAAAGAAGCTTAGCCTATTCTACAATGTCTCAATAGGGTTATATGATGTTAGCTCTCGGTATAGGT TCTTATGAAGCTGCTTTATTCCATTTGATAACTCATGCTTATTCGAAAGCTTTATTGTTTTTAGGATCCGGATCCGTTAT TCATTCAATGGAACCTCTTGTTGGATATTCACCAGATAAAAGTCAGAATATGGTTCTTATGGGTGGTTTAAGAAAATACG TTCCAATTACAAGAACTACTTTTTTATGTGGTACACTTTCTCTTTGTGGTATTCCACCTCTTGCTTGCTTCTGGTCCAAA GATGAAATCCTTAGTAATAGCTGGTTGTATTCACCTTTTTTTGGAATAATAGCCTCGTTTACTTCAAAATTA CAGCAGTACTAAAGATG GTTCGTTGTATTCAATATCCTTATGGGGAAAACGGATATCCAAAGGAGTCAATAGAGATTTGATTTTATCAACAATGAAG GATGGAGTTTCTTTTTTTTCACAAAATATACC CCAAATTCCTGGTAATACAAGAAATAAGATAGGATCCTTTAG TACTCCC TTTGGGGCTAAAAACACTTTTGTCTATCCTCATGAAACGGGAAATACAATGCTATTCTCTCTTCTTATATAACTGCTTTTTACTTTGTTCATTGGATCCATAGGAATCCATTTTGAT AATGGAATAAAGGTTAATGGAATATCGGAGTTAACCATATTATCAAAGTGGCTAACTCCTTCAATAAACTTTTTTGAGGA AAGTTCTAATTCTTCCATAAATTCATATGAATTTCTCATTAATGCAATTTCTTCTGTAAGTTTAGCAATTCTTGGTCTAT TCATAGCATATATCTTCTATGGATCCACTTATTCTTTTTTTCAGAATTTGAATTTTCTAAATTCCCTTGT AAAA GGGAATCAAAAAAAAAACTTTTTGGA TCAAGTAAAAGAAAAGATATACAGCTGGTCATATAATCGTGGTTATAT AGATGTTTTCTATACTAGGGTCTTTATCTTGGGTATAAGAAGATTAGCCGAACTAACGAATTTTTTCGATAAGGGTGTTA TTGATGGAATTATCAATGGAGTA Setaria verticillata ATGTCAATGGGATTTGGACTTTTTCTTATTCCGACAGCAACAAAAAATCTTCGTCGCATATGGGCTTTTCCTAGCATTTT ACTCTTAAGTATAGCTCTGGTATTCTCAGTTCACCTGTCTATTCAACAAATAAATGGAAGTTCTATCTATCAATATCTAT GGTCTTGGACCATCAATAACGATTTTTCTTTAGAATTTGGATACTTGATCGACCCCCTTACGTCTATTATGTTAATACTA ATTACTACTGTAGGAATCTTGGTTCTTATTTATAGTGACGATTATATGTCTCACGATGAAGGATATTTGAGATTTTTTGT TTATATAAGTTTTTTTAATACTGCCATGTTGGGATTGGTTACTAGTTCCAATTTGATACAAATTTATTTTTTTTGGGAAC TTGTCGGAATGTGTTCCTATTTATTGATAGGCTTTTGGTTTACACGGCCAATTGCAGCGAGTGCTTGCCAAAAAGCTTTT GTAACTAATCGTGTAGGGGATTTTGGTCTGTTATTATGAATTTTAGGTTTTTTTTGGATAACGGGTAGTTTAAAGTTTCG GGATTTGTTCAAAATAGCTAATAACTGGATTCCTAATAATGGGATTAATTCTTTACTTACTACTTTGTGTGCTTTTTTAT TATTCCTTGGTGCAGTTGCAAAATCCGCACAATTCCCTCTTCACGTATGGTTACCCGATGCTATGGAAGGACCCACTCCC ATTTCAGCTCTTATACACGCAGCAACTATGGTTGCTGCGGGGATTTTTCTTCTAGCTCGACTTCTTCCTCTTTTCATATC CCTACCCTTAATAATGAGTTTTATTTCTTTAGTAGGTATAATAACACTCTTCTTAGGAGCCACTTTAGCTCTTGCTC AGAGAGATATTAAAAGAAGCTTAGCCTAATCTACAATGTCTCAATTGGGTTATATGATGTTAGCTCTCGGTATAGGT TCTTATGAAGCTGCTTTATTCCATTTGATCACTCATGCTTATTCAAAAGCTTTATTGTTCTTAGGATCCGGATCCGTTAT TCATTCAATGGAACCTCTTGTTGGATATTCACCAGATAAAAGTCAGAATATGGTTCTTATGGGTGGTTTAAGAAAATACG TTCCAATTACAAGAACTACTTTTTTATGTGGTACACTTTCTCTTTGTGGTATTCCACCTCTTGCTTGCTTCTGGTCCAAA GATGAAATCCTTAGTAATAGCTGGTTGTATTCACCTTTTTTTGGAATAATAGCCTCTTTTACTGCAGGATTAACAGCATT TTATATGTTTCGGA CAAAATTANAGCAGTACTAAAGAGG GTTCGTTGTATTCANTATCCTTATGGGGAAAANGCATATCCAAAAGAGTCAATANAGATTTGATTTTATCAACAATGAAG GGTGGAGTTTCTTTTTTTTCACAAAATATACC CAAAATTCCTGGTAATACAAGAAATAAGATAGGATCCTTTAG TACTCCC TTTGGGGCTAAAAACACTTTTGTCTATCCTCATGAAACGGGAAATACTATGCTATTTCCTCTTCTTA NANTACTGCTTTTNACTTTGTTCATTGGATCCATAGGAATCCATTTTGATAATGGAATAAAGGTTAATGGAATATCGGAG TTAACCATATTATCAAAGNGGCTAACTCCTTCAATAAANTTTTTTGAGGAAAGTTNTAATTNTTCCATAAATTCGTANGA ATTTNTCATTAATGCAATTTTTTCTGTAAGTTTAGCAATTCTTGGTCTATTCATAGCANATATNTTCTATGGATNNANTT ATTCTTTTTTTCAGAATTTGAATTTTCTAAATTCCCTTGT AAAAGGGAATCAAAAAAAAAACTTTTTGGA TCAAGTAAAAGAAAAGATATACAGCTGGTCATATAATCGTGGTTATATAGATGTTTTCTATACTAGGGTCTTTATCTT GGGTATAAGAAGATTAGCCGAACTAACGAATTTTTTCGATAAGGGTGTTATTGATGGAATTATCANNGGANTA Setaria viridis ATGTCAATGGGATTTGGACTTTTTCTTATTCCGACAGCAACAAAAAATCTTCGTCGCATATGGGCTTTTCCTAGTATTTT ACTCTTAAGTATAGCTCTGGTATTCTCAGTTCACCTGTCTATTCAACAAATAAATGGAAGTTCTATCTATCAATATCTAT GGTCTTGGACCATCAATAACGATTTTTCTTTAGAATTTGGATACTTGATCGACCCCCTTACGTCTATTATGTTAATACTA ATTACTACTGTAGGAATCTTGGTTCTTATTTATAGTGACGATTATATGTCTCACGATGAAGGATATTTGAGATTTTTTGT TTATATAAGTTTTTTTAATACTGCCATGTTGGGGTTGGTTACTAGTTCCAATTTGATACAAATTTATTTTTTTTGGGAAC TTGTCGGAATGTGTTCCTATTTATTGATAGGCTTTTGGTTTACACGGCCAATTGCAGCGAGTGCTTGCCAAAAAGCTTTT GTAACTAATCGTGTAGGGGATTTTGGTCTGTTATTAGGAATTTTAGGTTTTTTTTGGATAACGGGTAGTTTAGAGTTTCG GGATTTGTTCAAAATAGCTAATAACTGGATTCCTAATAATGGGATTAATTCCTTACTTACTACTTTGTGTGCTTTTTTAT TATTCCTTGGTGCAGTTGCAAAATCCGCACAATTCCCTCTTCACGTATGGTTACCCGATGCTATGGAAGGACCCACTCCC ATTTCGGCTCTTATACACGCAGCAACTATGGTTGCTGC AGTTTTTCTTGTAGCTCGACTTTTTCCTCTTTTCATATC CCTACCCTTGATAATGAATTTTATTTCTTTAGTAGGTACAGTAACACTCTTCTTAGGAGCCACTTTAGCTCTTGCTC AGAGAGATATTAAAAGAAGCTTAGCCTATTCTACAATGTCTCAATTGGGTTATATGATGTTAGCTCTCGGTATAGGT TCTTATGAAGCTGCTTTATTCCATTTGATCACTCATGCTTATTCGAAAGCTTTATTGTTCTTAGGATCTGGATCCGTTAT TCATTCAATGGAACCTCTTGTTGGATATTCACCAGATAAAAGTCAGAATATGGTTCTTATGGGTGGTTTAAGAAAATACG TTCCAATTACAAGAACTACTTTTTTATGTGGTACACTTTCTCTTTGTGGTATTCCACCTCTTGCTTGCTTCTGGTCCAAA GATGAAATCCTTAGTAATAGCTGGTTGTATTCACCCTTTTTTGGAATAATAGCCTCTTTTACTGCAGGATTAACTGCATT TTATATGTTTCGGATATATTTACTTACTTTTGATGGGTATTTGCGTGTTCATTTTCAAAATTACAGCAGTACTAAAGAGG GTTCGTTGTATTCAATATCCTTATGGGGAAAAAGCATATCCAAAGGAGTCAATAGAGATTTTGTTTTATCAACAATGAAGGGTGGAGTTTCTTTTTTTTCACAAAATATACC CCAAATTCCTGGTAATACAAGAAATAAGATAGGATCCT TTAGTACTCCC TTTGGGGCTAAAAACACTTTTGTCTATCCTCATGAAACGGGAAATACTATGCTATTTCCTCTT CTTATATTACTGCTTTTTACTTTGTTCATTGGATCTATAGGAATCCATTTTGATAATGGAATAAAGGGTAATGAAATATC GGAGTTAACCATATTATCAAAGTGGCTAACTCCTTCAATAAACTTGTTCCAGGAAAGTTCTAATTCTTCCATAAATTCAT ATGAATTTCTCATTAATGCAATTTCTTCTGTAAGTTTAGCAATTCTTGGTCTATTCATAGCATATATCTTCTATGGATCT ACTTATTCTTTTTTTCAGAATTTGAATTTTCTAAATTCCCTTGT AAAAGGGAATCCAAAAAAGACTTTTTTGGA TCAAGTAAAAGAAAAGATATACAGCTGGTCATATAATCGTGGTTATATAGATGTTTTCTATACTAGGGTCTTTA TCTTGGGTACAAGAAGATTAGCCGAACTAACGAATTTTTTCGATAAGAGTGTTATTGATGGAATTATCAATGGAGTA Se taria palmifolia ATGTCAATGGGATTTGGACTTTTTCTTATTCCGACAGCAACAAAAAATCTTCGTCGCATATGGGCTTTTCCTAGTATTTT ACTCTTAAGTATAGCTCTGGTATTCTCAGTTCACCTGTCTATTCAACAAATAAATGGAAGTTCTATCTATCAATATCTAT GGTCTTGGACCATCAATAACGATTTTTCTTTAGAATTTGGATACTTGATCGACCCCCTTACGTCTATTATGTTAATACTA ATTACTACTGTAGGAATCTTGGTTCTTATTTATAGTGACGATTATATGTCTCACGATGAAGGATATTTGAGATTTTTTGT TTATATAAGTTTTTTTAATACTGCCATGTTGGGATTGGTTACTAGTTCCAATTTGATACAAATTTATTTTTTTTGGGAAC TTGTCGGAATGTGTTCCTATTTATTGATAGGCTTTTGGTTTACACGGCCAATTGCAGCGAGTGCTTGCCAAAA GCTTTT GTAACTAATCGTGTAAGGGATTT GGTCTGTTATTACGAATTTTAGGTTTTTTTTGGATAACGGGTAGTTTAAAGTTTCG GGATTTGTTCAAAATAGCTAATAACTGGATTCCTAATAATGGGATTAATTCTTTACTTACTACTTTGTGTGCTTTTTTAT TATTCCTTGGTGCAGTTGCAAAATCCGCACAATTCCCTCTTCACGTATGGTTACCCGATGCTATGGAAGGACCCACTCCC ATTTCGGCTCTTATACACGCAGCAACTATGGTTGCTGCGGGGATTTTTCTTCTAGCTCGACTTCTTCCTCTTTTCATATC CCTACCCTTAATAATGAGTTTTATTTCTTTAGTAGGTACAATAACACTCTTCTTAGGAGCCACTTTAGCTCTTGCTC AGAGAGATATTAAAAAAAGCTTAGCCTATTCTACAATGTCTCAATTGGGTTATATGATGTTAGCTCTCGGTATAGGT TCTTATGAAGCTGCTTTATTCCATTTGATCACTCATGCTTATTCGAAAGCTTTATTGTTCTTAGGATCCGGATCCGTTAT TCATTCAATGGAACCTCTTGTTGGATATTCACCAGATAAAAGTCAGAATATGGTTCTTATGGGTGGTTTAAGAAAATACG TTCCAATTACAAGAACTACTTTTTTATGTGGTACACTTTCTCTTTGTGGTATTCCACCTCTTGCTTGCTTCTGGTCCAAA GATGAAATCCTTAGTAATAGCTGGTTGTATTCACCTTTTTTTGGAATAATAGCCTCTTTTACTGCAGGATTAACAGCATT TTATATGTTTCGGATATNTTTACTTACTTTTGATGGGTATTTGCGTGTTCATTTTCAGAATTACAGCAGTACTAAAAAAG GTTCGTTGTATTCAATATCCTTATGGGGAAAAGGCATATCCAAAGGA TCAATAGAGATTTGATTTTATCAGCAATGAAG GGTGGAGTTTCTTTTTTTTCACAAAATATACC CAAAATTCCTGGTAATACAAGAAAAAAGATAGGATCCTTTAG TACTTCC TTTGGGGCTAAAAACACTTTTGTCTATCCTCATGAAACGGGAAATACTATGCTATTTCCTCTTCTTA TATTACTGCTTTTTACTTTGTTCATTGGATCCATAGGAATCCATTTTGATAATGGAATAAAGGTTAATGGAATATCGGAG TTAACCATATTATCAAAGTGGCTAACTCCTTCAATAAACTTTTTTGAGGAAAGTTCGAATTCTTCCATAAATTCATATGA ATTTCTCATTAATGCAATTTCTTCTGTAAGTTTAGCAATTCTTGGTCTATTCATAGCATATATCTTCTATGGATCTACTT ATTCTTTTTTTCAGAATTTGAATTTTCTAAATTCCCTTTT ACAAGGGAATCCAAAAAAAAACTTTATGGA TCAAGTAAAAGAAAAGATATACAGCTGGTCATATAATCGTGGTTATATAGATGTTTTCTATACTAGGGTCTTTATCTT GGGTATAAGAAGATTAGCCGAACTAACAAATTTTTTCGATAAGGGTGTTATTGATGGAATTATCAATGGAGTA Setaria sphacelata ATGTCAATGGGATTTGGACTTTTTCTTATTCCGACAGCAACAAAAAATCTTCGTCGCATATGGGCTTTTCCTAGTATTTT ACTCTTAAGTATAGCTCTGGTATTCTCAGTTCACCTGTCTATTCAACAAATAAATGGAAGTTCTATCTATCAATATCTAT GGTCTTGGACCATCAATAACGATTTTTCTTTAGAATTTGGATACTTGATCGACCCCCTTACGTCTATTATGTTAATACTA ATTACTACTGTCGGAATCTTGGTTCTTATTTATAGTGACGATTATATGTCTCACGATGAAGGATATTTGAGATTTTTTGT TTATATAAGTTTTTTTAATACTGCCATGTTGGGATTGGTTACTAGTTCCAATTTGATACAAATTTATTTTTTTTGGGAAC TTGTCGGAATGTGTTCCTATTTATTGATAGGCTTTTGGTTTACACGGCCAATTGCAGCGAGTGCTTGCCAAAAAGCTTTC GTAACTAATCGTGTAGGAGATTTTGGTCTGTTATTAGGAATTCTAGGTTTTTTTTGGATAACGGGTAGTTTAGAGTTTCG GGATTTGTTCAAAATAGCTAATAACTGGATTCCTAATAATGGGATTAATTCTTTACTTACTACTTTGTGTGCTTTTTTAT TATTCCTTGGTGCCGTTGCAAAATCCGCACAATTCCCTCTTCACGTATGGTTACCCGATGCTATGGAAGGACCCACTCCC ATTTCGGCTCTTATACACGCAGCAACTATGGTTGCTGCGGGGATTTTTCTTCTAGCTCGACTTCTTCCTCTTTTTATATC CCTACCCTTAATAATGAGTTTTATTTCTTTAGTAGGTACAATAACACTCTTCTTAGGAGCCACTTTAGCTCTTGCTCTTG CTCAGAGAGATATT TCTCTATTGGGTTAGAAAATGTTAGCTCTCGGTATAGGT TCTTATGAAGCTGCTTTATTCCATTTGATCACTCATGCTTATTCGAAAGCTTTATTGTTTTTAGGATCCGGATCCGTTAT TCATTCAATGGAACCTCTTGTTGGATATTCACCAGATAAAAGTCAGAATATGGTTCTTATGGGTGGTTTAAGAAAATACG TTCCAATTACAAGAACTACTTTTTTATGTGGTACACTTTCTCTTTGTGGTATTCCACCTCCTGCTTGCTTCTGGTCCAAA GATGAAATCCTTAGTAATAGCTGGTTGTATTCACCTTTTTTTGGAATAATAGCCTCTTTTACTGCAGGATTAACTGCNTT TTATTTGTTTCGGAAATATTTACTTACTTTTGAAGGGTATTTGCGTGTTCATTTTCAAAATTACAGCAGTACTAAAGAAGGTTCGTTGTATTCAATATCCTT ATGGGGAAAAGGCATATCCAAAGGAGTCAATAGAGATTTGATTTTATCAACAATGAAGGATGGAGTTTCTTTTTTTTCAC AAAATATACC CCAAATTCCTGGTAATACAAGAAATAAGATAGGATCCTTTAGTACTCCC TTTGGGGCT AAAAACACTTTTGTCTATCCTCATGAAACGGGAAATACAATGCTATTTCCTCTTCTTATATTACTGCTTTTTACTTTGTT CATTGGATCCATAGGAATCCATTTTGATAATGGAATAAAGGTTAATGGAATATCGGAGTTAACCATATTATCAAAGTGGC TAACTCCTTCAATAAACTTTTTTGAGGAAAGTTCTAATTCTTCTATAAATTCATATGAATTTCTCATTAATGCAATTTCT TCTGTAAGTTTAGCAATTCTTGGTCTATTCATAGCATATATCTTCTATGGATCCACTTATTCTTTTTTTCAGAATTTGAA TTTTCTAAATTCCCTTGT AAAAGGGAATCAAAAAAAAAACTTTTTGGA TCAAGTAAAAGAAAAGATAT ACAGCTGGTCATATAATCGTGGTTATATAGATGTTTTCTATACTAGGGTCTTTATCTTGGGTATAAGAAGATTAGCCGAA CTAACGAATTTTTTCGATAAGGGTGTTATTGATGGAATTATCAATGGAGTA Setaria parviflora ATGTCAATGGGATTTGGACTTTTTCTTATTCCGACAGCAACAAAAAATCTTCGTCGCATATGGGCTTTTCCTAGCATTTT ACTCTTAAGTATAGCTCTGGTATTCTCAGTTCACCTGTCTATTCAACAAATAAATGGAAGTTCTATCTATCAATATCTAT GGTCTTGGACCATCAATAACGATTTTTCTTTAGAATTTGGATACTTGATCGACCCCCTTACGTCTATTATGTTAATACTA ATTACTACTGTAGGAATCTTGGTTCTTATTTATAGTGACGATTATATGTCTCACGATTGAGGATATTTGAGATTTTTTGT TTACATAAGTTTTTTTAATACTGCCATGTTGGGATTGGTTACTAGTTCCAATTTGATACAAATTTATTTTTTTTGGGAAC CGGTCGGAATGTGTTCCTATCTATTGATAGGCTTTTGGTTTACACGGCCA NNNN NNNNNTAATCGNTTAGGGGATTTAGGTCTGTTATTAGGAATTTTAGGTTTTTTTTGGATAACGGGTAGTTTAAAGTTTCG GGATTTGTTCAAAATAGCTAATAACTGGATTCCTAATAATGGGATTAATTCTTTACTTACTACTTTGTGTGCTTTTTTAT TATTCCTTGGTGCAGTTGCAAAATCCGCACAATTCCCTCTTCACCTATGGTTACCCGATGCTATGGAAGGACCCACTCCC ATTTCAGCTCTTATACACGCAGCAACTATGGTTGCTGCGGGGATTTTTCTTCTACCTCGACTTCTTCCTCTTTTCATATC CCTACCCTTAATAATGAGTTTTATTTCTTTAGTAGGTATAATAACACTCTTCTTAGGAGCCACTTTAGCTCTTGCTC CGAGAGATATTAAAAGAAGCTTAGCCTATTCTACAATGTCTCAATTGGGTTATATGATGTTAGCTCTCGGTATAGGT TCTTATGAAGCTGCTTTATTCCATTTGATCACTCATGCTTATTCAAAAGCTTTATTGTTCTTACGATCCGGATCCGTTAT TCATTCAATGGAACCTCTTGTTGGATATTCACCAGATAAAAGTCAGAATATGGTTCTTATGGGTGGTTTAAGAAAATACG TTCCAATTACAAGAACTACTTTTTTATGTGGTACACTTTCTCTTTGTGGTATTCCACCTCTTGCTTGCTTCTGGTCCAAA GATGAAATCCTTAGTAATAGCTGGTTGTATTCACCTTTTTTTGGAATAATAGCCTCTTTTACTGCAGGATTAACTGCATT TTATTTGTTTCGGATATATTTACTTACTTTTGATGGGTATTTGCGTGTTCATTTTCAAAATTACAGCAGTACTAAAGAAG GTTCGTTGTATTCAATATCCTTATGGGGAAAAGGCATATCCAAAGGAGTCAATAGAGATTTGATTTTATCAACAATGAAG GGTGGAGTTTCTTTTTTTTCACAAAATATACC CAAAATTCCTGGTAATACAAGAAATAAGATAGGATCCTTTAG TACTCCC TTTGGGGCTAAAAACACTTTTGTCTATCCTCATGAAACGGGAAATACTATGCTATTTCCTCTTCTTA TATTACTGCTTTTTACTTTGTTCATTGGATCCATAGGAATCCATTTTGATAATGGAATAAAGGTTAATGGAATATCGGAG TTAACCATATTATCCAAGTGGCTAACTCCTTCACTAAACTTTTTTTAGGAAAGTTCTAATTCTTCCATAAATTCGTATGA ATTTCTCATTAAGGCAATTTCTTCTGTAAGTTTAGCAATTCTTGGTCTATTCATAGCATATATTTTCTATGGATCTACCT ATTCTTTTTTTCAGAATTTGAATTTTCTAAATTCCCTTGT AAAAGGGAATCCAAAAAAAAACTTTTTGGA TCAAGTAAAAGAAAAGATATACAGCTGGTCATATAATCGTGGTTATATAGATGTTTTCTATACTAGGGTCTTTATCTT GGGTATAAGAAGATTAGCCGAACTAACGAATTTTTTCGATAAGGGTGTTATAGATGGAATTATCAATGGANTN Setaria lachnea ATGTCAATGGGATTTGGACTTTTTATTATTCCGACAGCAACAAAAAATCTTCGTCGCATATGGGCTTTTCCTAGTATTTT ACTCTTAAGTATAGCTCTGGTATTCTCAGTTCACCTGTCTATTCAACAAATAAATGGAAGTTCCATCTATCAATATCTAT GGTCTTGGACCATCAATAACGATTTTTCTTTAGAATTTGGATACTTGATCGACCCCCTTACGTCTATTATGTTAATACTA ATTACTACTGTAGGAATCTTGGTTCTTATTTATAGTGACGATTATATGTCTCACGATGAAGGATATTTGAGATTTTTTGT TTATATAAGTTTTTTTACTACTGCCATGTTGGGGTTGGTTACTAGTTCCAATTTGATACAAATTTATTTTTTTTGGGAAC TTGTCGGAATGTGTTCCTATTTATTGATAGGCTTTTGGTTTACACGGCCAATTGCAGCGAGGGCTTGCCAAAAAGCTTTT GTAACTAATNGTGTAGGGGATTTTGGTCTGTTATTAGGAATCTTAGGTTTTTTTTGGATAACGGGTAGTTTAGAGTTTCG AGATTTGTTCAAAATAGCTAATAACTGGATTCCTAATAATGGGATTAATTCCTTACTTACTACTTTGTGTGCTTTTTTAT TATTCCTTGGTGCAGTTGCAAAATCCGCACAATTCCCTCTTCACGTATGGTTACCCGATGCTATGGAAGGACCCACTCCC ATTTCGGCTNTTATACACGCAGCAACTATGGTTGCTGCGGGGATTTTTCTTGTAGCTCGACTTTTTCCTCTTTTCATATC CCTACCCTTGATAATGAGTTTTATTTCTTTAGTAGGTACAATAACACTCTTCTTAGGAGCCACTTTAGCTCTTGCTC AGAGAGATATTAAAAGAAGCTTAGCCTATTCTACAATGTCTCAATTGGGTTATATGATGTTAGCTCTCGGTATAGGT TCTTATGAAGCTGCTTTATTCCATTTGATCACTCATGCTTATTCGAAAGCTTTATTGTTCTTAGGATCCGGATCCGTTAT TCATTCAATGGAACCTCTTGTTGGATATTCACCAGATAAAAGTCAGAATATGGTTCTTATGGGTGGTTTAAGAAAATACG TTCCAATTACAAGAACTACTTTTTTATGTGGTACACTTTCTCTTTGTGGTATTCCACCTCTTGCTTGCTTCTGGTCCAAAGATGAAATCCTTAGTAATAGCTGGTTGTATTCACCTTTTTTTGGAATA ATAGCCTCTTTTACTGCAGGATTAACTGCATTTTATATGTTTCGGATATATTTACTTACTTTTGATGGGTATTTGCGTGT TCATTTTCAAAATTACAGCAGTACTAAAGAAGGTTCGTTGTATTCAATATCCTTATGGGGAAAAGGCATATCCAAAGGAG TCAATAGAGATTTTGTTTTATCAACAATGAAGGGTGGAGTTTCTTTTTTTTCACAAAATATACC CAAAATTCCT GGTAATACAAGAAATAAGATAGGATCCTTTAGTACTCCC TTTGGGGCTAAAAACACTTTTGTCTATCCTCATGA AACGGGAAATACTATGCTATTTCCTCTTCTTATATTACTGCTTTTTACTTTGTTCATTGGATCCATAGGAATCCATTTTG ATAATGGAATAAAGGGTAATGGAATATCGGAATTAACCATATTATCAAAGTGGCTAACTCCTTCAATAAACTTTTTCCAG GAAAGTTCTAATTCTTCCATAAATTCATATGAATTTCTCATTAATGCAATTTCTTCTGTAAGTTTAGCAATTCTTGGTCT ATTCATAGCATATATCTTCTATGGATCTACTTATTCTTTTTTTCAGAATTTGAATTTTCTAAATTCCCTTGT AA AAGGGAATCCAAAAAAAAACTTTTTGGA TCAAGTAAAAGAAAAGATATACAGCTGGTCATATAATCGTGGTTAT ATAGATGTTTTCTATACTAGGGTCTTTATCTTGGGTATAAGAAGATTAGCCGAACTAACGAATTTTTTCGATAAGGGTGT TATTGATGGAATTATCAATGGAGTA Stenotaphrum secundatum ATGTCAATGGGATTTGGACTTTTTCTTATTCCAACAGCAACAAAAAATCTTCGTCGCATATGGGCTTTTCCTAGTATTTT ACTCTTAAGTATAGCTCTGGTATTCGCAGTTCACCTGTCTATTCAACAAATAAATGGAAGTTCTATCTATCAATATCTAT GGTCTTGGACCATCAATAACGATTTTTCTTTAGAATTTGGATACTTGATCGACCCCCTTACGTCTATTATGTTAATACTA ATTACTACTGTAGGAATCTTGGTTCTTATTTATAGTGACGATTATATGTCTCACGATGAAGGATATTTGAGATTTTTTGT TTATATAAGTTTTTTTAATACTGCCATGTTGGGGTTGGTTACTAGTTCCAATTTGATACAAATTTATTTTTTTTGGGAAC TTGTCGGAATGTGTTCCTATTTATTGATAGGCTTTTGGTTTACACGGCCAATTGCAGCGAGTGCTTGCCAAAAAGCTTTT GTAACTAATCGTGTAGGGGATTTTGGTCTGTTATTAGGAATTTTAGGTTTTTTTTGGATAACGGGTAGTTTAGAGTTTCG GGATTTGTTCAAAATAGCTAATAACTGGATTCCTAATAATGGGATTAATTCCTTACTTACTACTTTGTGTGCTTTTTTAT TATTCCTTGGTGCAGTTGCAAAATCCGCACAATTCCCTCTTCACGTATGGTTACCCGATGCTATGGAAGGACCCACTCCC ATTTCGGCTCTTATACACGCAGCAACTATGGTTGCTGCGGGGATTTTTCTTATAGCTCGACTTCTTCCTCTTTTCATATC CCTACCCTTGATAATGGGTTTTATTTCTTTAGTAGGTACAATAACACTCTTCTTAGGAGCCACTTTAGCTCTTGCTC AGAGAGATATTAAAAGAAGCTTAGCCTATTCTACAATGTCTCAATTGGGTTATATGATGTTAGCTCTCGGTATAGGT TCTTATGAAGCTGCTTTATTCCATTTGATCACTCATGCTTATTCGAAAGCTTTATTGTTCTTAGGATCCGGATCCGTTAT TCATTCAATGGAACCTCTTGTTGGATATTCACCAGATAAAAGTCAGAATATGGTTCTTATGGGTGGTTTAAGAAAATACG TTCCAATTACAAGAACTACTTTTTTATGTGGTACACTTTCTCTTTGTGGTATTCCACCTCTTGCTTGCTTCTGGTCTAAA GATGAAATCCTTAGTAATAGCTGGTTGTATTCACCTTTTTTTGGAATAATAGCCTCTTTTACTGCAGGATTAACTGCATT TTATATGTTTCGGATATATTTACTTACTTTTGATGGGTATTTACGTGTTCATTTTCAAAATTACAGCAGTACTAAAGAAG GTTCGTTGTATTCAATATCCTTATGGGGAAAAGGCATATCCAAAGGAGTCAATAAAGATTTTGTTTTATCAACAATGAAG GGTGGAGTTTCTTTTTTTTCACAAAATATACC CCAAATTCCTGGTAATACAAGAAATAAGATAGGATCCTTTAG TACTCCC TTTGGGGCTAAAAAAACTTTTGTCTATCCTCATGAAACGGGAAATACTATGCTATTTCCTCTTCTTA TATTACTGCTTTTTACTTTGTTCATTGGATCCATAGGAATCCATTTTGATAATGGAATAAAGGGTAATGGAATATCGGAG TTAACCATATTATCAAAGTGGCTAGCTCCTTCAATAAACTTTTTCGAGGAAAGTTCTAATTCTTCCATAAATTCATATGA ATTTCTCATTAATGCAATTTCTTCTGTAAGTTTAGCAATTCTTGGTCTATTCATAGCATATATCTTCTATGGATCTACTT ATTCTTTTTTTCAGAATTTGAATTTTCTAAATTCCCTTGT AAAAGGGAATCAAAAAAAAAACTTTTTGGA TCAAGTAAAAGAAAAGATATACAGCTGGTCATATAATCGTGGTTATATAGATGTTTTCTATACTAGGGTCTTTATCTT GGGTATAAGAAGATTAGCCGAACTAACGAATTTTTTCGATAAGGGTGTTATTGATGGAATTACCAATGGAGTG Steinchisma hians ATGTCAATGGGATTTGGACTTTTTCTTATTCCGACAGCAACAAAAAATCTTCGTCGCATATGGGCTTTTCCTAGTATTTT ACTCTTAAGTATAGCTATGATATTCTCAGTTCACCTGTCTATTCAACAAATAAATGAAAGTTCTATCTATCAATATCTAT GGTCTTGGACCATCAATAATGATTTTTCCTTAGAATTTGGATACTTGATCGACCCCCTTACGTCTATTATGTTAATACTA ATTACTACTGTAGGAATCTTGGTTCTTATTTATAGTGACGATTATATGTCTCACGATGAAGGATATTTGAGATTTTTTGT TTATATAAGTTTTTTTAATACTTCCATGTTGGGATTGGTTACTAGTTCCAATTTGATACAAATTTATTTTTTTTGGGAAC TTATCGGAATGTGTTCCTATTTATTGATAGGCTTTTGGTTTACACGGCCAATTGCAGCGAGTGCTTGTCAAAAAGCTTTT GTAACTAATCGTGTAGGAGATTTTGGTCTGTTATTAGGAATTTTAGGTTTTTTTTGGATAACGGGTAGTTTAGAGTTTCG GGATTTGTTCAAAATAGCTAATAACTGGATTCCTAATAATGGGATTAATTCCTTACTTACTACTTTGTGTGCTTTTTTAT TATTCCTTGGTGCAGTTGCAAAATCTGCACAATTCCCTCTTCACGTATGGTTACCAGATGCTATGGAAGGACCCACTCCC ATTTCGGCTCTTATACATGCAGCAACTATGGTTGCCGCGGGGATTTTTCTTTTAGCTCGACTTCTTCCTCTTTTCATATC TCTACCCTTGATAATGAGTTTCATTTCTTTAGTAGGTACAATAACACTCTTCTTAGGAGCCACTTTAGCTCTTGCTC AGAGAGATATTAAAAGAAGTTTAGCCTATTCTACAATGTCTCAATTGGGTTATATGATGTTAGCTCTAGGTATAGGT TCTTATCAAGCTGCTTTATTCCATTTGATCACTCATGCTTATTCGAAAGCTTTATTGTTCTTAGGATCCGGATCCGTTATTCATTCAATGGAACCTCTTGTTGGATATTCACCAGATAAAAGTCAGAATATGGTTCTTATGGGTGGTTTAAGAA AATACGTTCCAATTACAAGAACTACTTTTTTATGTGGTACACTTTCTCTTTGTGGTATTCCACCTCTTGCTTGCTTCTGG TCCAAAGATGAAATCCTTAGTAATAGTTGGTTGTATTCACCCTTTTTTGGAATAATAGCCTCTTTTACTGCAGGATTAAC YGCATTTTATATGTTTCGGATATATTTACTTACTTTTGATGGGTATTTGCGTGTTCATTTTCAAAATTACAGCAGTACTA AAGAAGGTTCATTGTATTCAATATCTTTATGGGGAAAAAGTATATCCAAAGGAGTCAATAGGGATTTTGTTTTATCAACA ACGAGGAGTGGGGCTTCTTTTTTTTCACAAAATATACC TAAAATTCCTGGTAATACAAGAAATAAGATAGGATC CTTTAGTACTCCC TTTGGGGCTAAAAACACTTTTGTCTATCCTCATGAAACGGGAAATACTATGCTATATCCTC TTCTTATATTACTGCTTTTTACTTTGTTCATTGGATCCATAGGAATCCATTTTGATAATGGGGTAAAGGATAATGGAATA TCGGAGTTAACCGTATTATCAAAGTGGCTAACTCCTTCAATAAACTTTTTCCAGGAAAGTTCTAATTCTCCCATAAATTC CTATGAATTTCTCACTAATGCAATTTCTTCTGTAAGTTTAACAATTTTGGGTCTATTCATAGCATATATCTTCTATGGAT CTGCTTATTATTTTTTTCAAAATTTGCATTTCAAAAATTCC ATAAAAAGGAATCCAAAAAAGAACTTTTTG GA TGAAGTAAAAAAAAAGATATACAGCTGGTCATATAATCGTGGTTATATAGATGTTTTCTATACTAGGGTATT TATTTTGGGTATAAGAAGATTAGCAGAACTAACACATTTTTTCGATAAAGGTGTCATTGATGCAATTACCAATGGAGTA Streptostachys ramosa ATGTYAATGGGATKTGGGCTTTTTCTTATTCMGACAGCAACAAAAAATCTTCGTCGCATATGGGCTTTTCCTAGTATTTT ACTCTTAAGTATAGCTATGGTATTCTCAGTTCACCTGTCTATTCAACAAATAAATGGAAGTTCTATCTATCAATATCTAT GGTCTTGGACCATCAATAATGATTTTTCCTTAGAATTTGGATACTTGATCGACCCCCTTACGTCTATTATGTTAATACTA ATTACTACTGTAGGAATCTTGGTTCTTATTTATAGTGACGATTATATGTCTCACGATGAAGGATATTTAAGATTTTTTGT TTATATAAGTTTTTTTAATACTTCCATGTTGGGATTGGTTACTAGTTCCAATTTGATACAAATTTATTTTTTTTGGGAAC TTATCGGAATGTGTTCCTATTTATTGATAGGCTTTTGNTTTACACGGCCAANNNNNNNNNGTGTTTGTCAAAAAGCTTTT GTAAMTAATCGTGTAGGGGATTTTGGTCTGTTATTAGGAATTTTAGGTTTTTTTTGGATAACGGGTAGTTTAGAGTTTCG GGATTTGTTCAAAATAGCTAATAANTGGATTCCTAATAATGGGATTAATTCCTTACTTAMTACTTTGTGTGCTTTTTTAT TATTCCTTGGTGCAGTTGCAAAATCCGCACAATTCCCTYTTCANGTATGGTTACCCGATGCTATGGAAGGACCCACTCCC ATTTCGGNTYTTATACACGCAGCAANTATGGTTGCCGCGGGGATTTTTNTTTTAGCTCGAMTTYTTCCTYTTTTCATACC CCTACCCTTGATAATGAGTTTCATTTCTTTAGTGGGTACAATAACACTCTTCTTAGGAGCCACTTTAGCTCTTGCTC AGAGAGATATTAAAAAAANTTTAGCCTATTCTACAATGTCTCAATTGGGTTATATGATGTTAGCTCTAGGTATAGGT TCTTATCAAGCTGCTTTATTCCATTTGATCACTCATGCTTACTCGAAAGCTTTATTGTTCTTAGGATCCGGATCCGTTAT TCATTCAATGGAACCTCTTGTTGGATATTCACCAGATAAAAGTCAAAATATGGTTCTTATGGGTGGTTTAAGAAAATACG TTCCAATTACAAAAACTACTTTTTTATGTGGTACACTTTCTCTTTGTGGTATTCCACCTCTTGCTTGCTTCTGGTCCAAA GATGAAATCCTTAGTAATAGTTGGTTGTATTCACCCTTTTTTGGAATAATAGCCTCTTTTACTGCAGGATTAACTGCATT TTATATGTTTCGGATATATTTACTTACTTTTGATGGGTATTTGCGTGTTCATTTTCAAAATTACAGCAGTACTAAAGAAG GTTCGTTGTATTCAATATCCTTATGGGGAAAAAGTATATCCAAAGGAGTCAATAGGGATTTTGTTTTATCAACAACGAAG AGTGGAGTTTCTTTTTTTTCACAAAATATACC TAAAATTCCTGGGAATACAAGAAATAAGATAGGATTCTTTAA TACTCCC TTTGGGGCTAAAAAAACTTTTGTCTATCCTCATGAAACGGGAAATACTATGCTATATCCTCTTCTTA TATTACTGCTTTTTACTTTGTTCATTGGATCCATAGGAATCCATTTTGATAATGGGGTAAAGGATAATGGAATATCCGAG TTAACCATATTATCAAAATGGCTAACTCCTTCGATAAACTTTTTCCAGGAAAGTTCTAATTCTTCCATAAATTCCTATGA ATTTATTACTTATGCAATTTATTCTGTAAGTTTAGCAATTTTTGGTCTATTCATAGCANATATMTTCTATGGATCCGCTT ATTATTTTTTTCAGAATTTGAATTTTCAAAATTCCCTTGTAAAAATAAAAATGAATCCAAAAAAGAGCTTTTTGGA TGAAGTAAAAAAAAAGATATATAGCTGGTCATATAATCGTGGTTATATAGATGTTTTCTATACTAGGGTATTTATCCT GGGTATAAGAAAATTGGCAGAACTAACCCATTTTTTAGATAAAGGTGTCGTTGATGGAATTACCAATGGAGTG Streptostachys asperifolia ATGTCAATGGGATTTGGACTTTTTATTATTCCGACAGCAACAAAAAATCTTCGTCGCATATGGGCTTTTCCTAGTATTTT ATTCTTAAGTATAGCTATGGTATTCTCAGTTTACCTGTCTATTCAACAAATAAATGGAAGTTCGATCTATCAATATCTAT GGTCTTGGACCATCAATAATGATTTTTCCTTAGAATTTGGATACTTGATCGACCCCCTTACGTCTATTATGTTAATACTA ATTACTACTGTAGGAATCTTGGTTCTTATTTATAGTGACGATTATATGTCTCACGATGAAGGATATTTGAGATTTTTTGT TTATATAAGTTTTTTTAATACTTCCATGTTGGGATTGGTTACTAGTTCCAATTTGATACAAATTTATTTTTTTTGGGAAC TTATCGGAATGTGTTCCTATTTATTGATAGGCTTTTGGTTTACACGGCCAATTGCAGCGAGTGCTTGTCAAAAAGCTTTT GTAACTAATCGTGTAGGGGATTTTGGTCTGTTATTAGGGATTTTAGGTTTTTTTTGGATAACGGGTAGTTTAGAGTTTCG GGATTTGTTCAAAATAGCTAATAACTGGATTCCTAATAATGGGATTAATTCCTTATTTACTACTTTGTGTGCTTTTTTAT TATTCCTTGGTGCAGTTGCAAAATCTGCACAATTCCCTCTTCACGTATGGTTACCCGATGCTATGGAAGGACCCACTCCC ATTTCGGCTCTTATACACGCAGCAACTATGGTTGCCGCGGGGATTTTTCTTTTAGCTCGACTTCTTCCTCTTTTCATATC CCTACCTTTGATAATGAATTTCATTTCTTTAGTAGGTACAATAACACTCTTCTTAGGAGCCACTTTAGCTCTTGCTC AGAGAGATATTAAAAGAAGTTTAGCCTATTCTACAATGTCTCAATTGGGTTATATGATGTTAGCTCTAGGTATAGGTTCTTATCAAGCTGCTTTATT CCATTTGATCACTCATGCTTATTCGAAAGCTTTATTGTTCTTAGGATCAGGATCCGTTATTCATTCAATGGAACCTCTTG TTGGATATTCACCAGATAAAAGTCAGAATATGGTTCTTATGGGCGGTTTAAGAAAATACATTCCAATTACAAGAACTACT TTTTTATGTGGTACACTTTCTCTTTGTGGTATTCCACCTCTTGCTTGCTTCTGGTCCAAAGATGAAATCCTTAGTAATAG TTGGTTGTATTCACCCTTTTTTGGAATAATAGCCTCTTTTACTGCAGGATTAACCGCATTTTATATGTTCGNNNNNNNNN NN GATGGGTATTTGCGTGTTCATTCTCCAAATTACAGCAGTACTAAAGAAGGGTNGTTGTANTCAAAATCC TTATGGGGAAAAAGTATATCCAAAGGGGTCAATATGGATTTAGTTTTATCAACAACGAAGAGTGGAGTTTCTTTTTTTTC ACAAAATATGCC TAAAATTCCTCGTAATACAAGAAATAAGATGGGATCCTTTAGTACTCCC TTTGGGG CTAAAAAAACTTTTGTCTATCCTCATGAAACGGGAAATACTATGCTATATCCTCTTCTTATATTACTGCTTTTTACTTTG TTCATTGGATCCATAGGAATCCATTTTGATAATGGAGTAAAGGATAATGGAATATCGGAGTTAACTATATTATCAAAGTG GCTAACTCCTTCGATAAACTTTTTCCAGGAAAGTTCTAATTCTTCCATAAATTCCTATGAATTTCTCACTAATGCAATTT ATTCTGTAAGTTTAGCTATTTTTGGTCTATTCATAGCATATATCTTCTATGGATCCGCTTATTATTTTTTTCAAAATTTG AATTTCCAAAATTCCCTTGTAAAAATAAAAAGGAATCCAAAAAATAACTTTTTGGA TGAAGTAAAAAAAAAGAT ATACAGCTGGTCATATAATCGTGGTTATATAAATGTTTTCTATACTAAAGTATTTATCCTGGGTATAAAAAAATTAGCAN AACTAACACATTTTTTCGATAAAGGTGTCATTGATGGAATTATCAATGGANTA Tatianyx arnacites ATGTCAATGGGATTTGGACTTTTTCTTATTCCGACAGCAACAAAAAATCTTCGTCGCATATGGGCTTTTCCTAGTATTTT ACTCTTAAGTATAGCTATGGTATTCTCAGTTCACCTGTCTATTCAACAAATAAATGGGAGTTCCATCTATCAATATCTAT GGTCTTGGACCATCAATAATGATTTTTCCTTAGAATTTGGATACTTGATCGACCCCCTTACGTCTATTATGTTAATACTA ATTACTACTGTAGGAATCTTGGTTCTTATTTATAGTGATGATTATATGTCTCACGATGAAGGATATTTGAGATTTTTTGT TTATATAAGTTTTTTTAATACTTCCATGTTGGGATTGGTTACTAGTTCCAATTTGATACAAATTTATTTCTTTTGGGAAC TTATCGGAATGTGCTCCTATTTATTGATAGGGTTTTGGTTTACACGGCCAATTGCAGCAAGTGCTTGTCAAAAAGCTTTT GTAACTAATCGTGTAGGGGATTTTGGTCTGTTATTAGGAATTTTAGGTTTTTTTTGGATAACGGGTAGTTTAGAGTTTCG GGATTTGTTCAAAATAGCTAATAACTGGATTCCTAATAATGGAATTAATTCCTTACTTACTACTTTGTGTGCTTTTTTAT TATTCCTTGGTGCAGTTGCAAAATCTGCACAATTCCCTCTTCACGTATGGTTACCCGATGCTATGGAAGGACCCACTCCC

    Original URL path: http://ajbsupp.botany.org/v88/giussani.txt (2016-02-14)
    Open archived version from archive



  • Sommera TGATAACTTTCAAATTCAGAGAAACCCCGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCGAAAAcTTCAGAAAa GGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACAACCCGACTGA ATCCGTAaTTTTTATATaGAAAACATAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCCTAaTATTCAcTTGATCAAATGATTAACcTCCATAGTCTGcATAGATCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCATATTTGACcTCCCCa aAACTATa a TTAcTCCTATCCCTCTTTCCGTTAGCGGTTCAAAATCCCTTATTCATTCACTC TAa a a TTaCTCGTa a a AGAAcATCGATCTGGACGGAAATGCCaCTTa TTCTT ATCACAaAGTCTaTGTGT TatatATGATaATa Aa cCATACAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAACTACTCATACTGAAAATTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCCACTACCTAGATAAAACTTGGTAATCCACTTTCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTAATAAAATGAGGATGCTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Simira TGATAACTTTCAAATTCAGAGAAACCCCGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCa AAAa GAcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCGAAAAcTTCAGAAAcGGAT AcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa acATCAAAaTGATTa AATGACAACCCGACTGA ATCTGTAaTTTTTATATaGAAAACAGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGTAaTATTCAcTTGATCAAATGATTAACcTCCATAGTCTGcATAGATCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCATATTTGACcTCCCCa aAACTATa a TTAcTCCTATCCCTCTTTTCGTTAGCGGTTCAAAATCCCTTATTCATTCACTC TAa a a TTaCTCGTa a a AGAAcATCGATCTGGACGGAAATGCCaCTTa TTCTT ATCACAaAGTCTaTGTGT TatatATGATaATa Aa cCATACAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAACTACTCATACTGAAACTTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCCACTACCTAGATAAAACTTTGTAATCCACTTTCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTAATAAAATGAGGATGCTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Parachimarrhis TGATAACTTTCAAATTCAGAGAAACCCCGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCGAAAAcTTCAGAAAcGGAT AcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACAACCCGACTGA ATCTGTAaTTTTTATATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGTAaTATTCAcTTGATCAAATGATTAACcTCCATAGTCTGcATAGATCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTCGGCAACAATGAAATTTAGAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCATATTTGACcTCCCCa aAACTATa a TTAcTCCTATCCCTCTTTTCGTTAGCGGTTCAAAATCCCTTATTCATTCACTC TAa a a TTaCTCGTa a a AGAAcATCGATCTGGACGGAAATGCCaCTTa TTCTT ATCACAaAGTCTaTGTGT TatatATGATaATa Aa cCATACAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAACTACTCATACTGAAACTTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCCACTACCTAGATAAAACTTTGTAATCCACTTTCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTAATAGAATGAGGATGCTACATTGaGGATTGGTCGGGATAGCTCAGCTGG Bathysav TGATAACTTTCAAATTCAGAGAAACCCCGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTACGTTAGTAGAGAAATCTTTCCATCGAAAAcTTCAGAAAcGGAT AcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACAACCCGACTGA ATCTGTAaTTTTTATATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGTAaTATTCAcTTGATCAAATGATTAACcTCCATAGTCTGcATAGATCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCATATTTGACcTCCCCa aAACTATa a TTAcTCTTATCCCTCTTTTCGTTAGCGGTTCAAAATCCCTTATTCATTCACTC TAa a a TTaCTCGTa a a AGAAcATCGATCTGGACGGAAATGCCaCTTa TTCTT ATCACAaAGTCTaTGT TatatATGATaATa Aa cCATAGAa AATcGAAcCaATATTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAACTACTTATACTGAAACTTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCCACTACCTAGATAAAACTTTGTAATCCACTTTCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTAATAAAATGAGGATGCTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Rustia TGATAACTTTCAAATTCAGAGAAACCCCGGAATaTAATAAAAAcAGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAAAGAAATCTTTCCATCGAAAAcTTCAGAAAcGGAT AcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACAACCCGACTGA ATCTGTAaTTTTTATATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGTAaTATTCAcTTGATCAAATGATTAACcTCCATAGTCTGcATAGATCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCATATTTGACcTCCCCa aAACTATa Ta TTAcTCCTATCCCTCTTTTCGTTAGCGGTTCAAAATCCCTTATTCATTCACTC TAa a a TTaCTCGTa a a AGAAcATCGATCTGGACGGAAATGCCaCTTa TTCTT ATCACAaAGTCTaTGTGT TatatATGATaATa Aa cCATACAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAACTACTCATACTGAAACTTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCCACTACCTAGATAAAACTTTGTAATCCACTTTCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTAATAAAATGAGGATGCTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Pogonopus TGATAACTTTCAAATTCAGAGAAACCCCGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCCTTCCATCGAAAAcTTCAGAAAcGGAT AcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACAACCCGATTGA ATCTGTAaTTTTTATATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGTAaTATTCAcTTGATCAAATGATTAACcTCCATAGTCTGcATAGATCTTTTCAAGAACCGATTa AATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCATATTTGACcTCCCCa aAACTATa a TTAcTCCTATCCCTCTTTTCGTTAGCGGTTCAAAATCCCTTATTCATTCACTC TAa a a TTaCTCGTa a a AGAAcATCGATCTGGACGGAAATGCCaCTTa TTCTT ATCACAaAGTCTaTGTGT TatatATGATaATa Aa cCATACAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAACTACTCATACTGAAACTTACAAAGcTACaTCTTTT aTTAAAATaCCAAGAAATTCCACTACCTAGATAAAACTTTGTAATCCACTTTCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTAATAAAATGAGGATGCTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Picardaea TGATAACTTTCAAATTCAGAGAAACCCCGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCGAAAAcTTCAGAAGcGGAT AcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACAACCCGACTGA ATCTGTAaTTTTTATAGaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGTAaTATTCAcTTGATCAAATGATTAACcTCCATAGTCTGcATAGATCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAA a ccctctatccccAAAAAGCATATTTGACcTCCCCa aAACTATa a TTAcTCCTATCCCTCTTTTCGTTAGCGGTTCAAAATCCCTTATTCATTCACTC TAa a a TTaCTCGTa a a AGAAcATCGATCTGGACGGAAATGCCaCTTa TTCTT ATCACAaAGTCTaTGTCT TatatATGATaATa Aa cCATACAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTCTCCATTTGAATGATTTACAATCGAaTcAcaTAACTACTCATACTGAAACTTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCCACTACCTAGATAAAACTTTGTAATCCACTTTCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTAATAAAATGAGGATGCTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Pentagonia490 TGATAACTTTCAAATTCAGAGAAACCCCGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCGAAAAcTTCAGAAAa GGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACAATACGACTGA ATCTGTAaTTTTTATATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGTAaTATTCAcTTGATCAAATGATTAACcTCCATAGTCTGcATAGATCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCATATTTGACcTCCCCa aAACTATa a TTAcTCCTATCCCTCTTTTCGTTAGCGGTTCAAAATCCCTTATTCATTCACTC TAa a a TTaCTCGTa a a AAAAcATCGATCTGGACGGAAATGCCaCTTa TTCTT ATCACAaAGTCTaTGTGT TatatATGATaATa Aa cCATACAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAACTACTCATACTGAAACTTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCCACTACCTAGATAAAACTTTGTAATCCACTTTCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTAATAAAATGAGGATGCTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Pentagonia488 TGATAACTTTCAAATTCAGAGAAACCCCGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCGAAAAcTTCAGAAAa GGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACAATCCGACTGA ATCTGTAaTTTTTATATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGTAaTATTCAcTTGATCAAATGATTAACcTCCATAGTCTGcATAGATCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCATATTTAACcTCCCCa aAACTATa a TTAcTCCTATCCCTCTTTTCGTTAGCGGTTCAAAATCCCTTATTCATTCACTC TAa a a TTaCTCGTa a a AGAAcATCGATCTGGACGGAAATGCCaCTTa TTCTT ATCACAaAGTCTaTGTGT TatatATGATaATa Aa cCATACAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAACTACTCATACTGAAACTTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCCACTACCTAGATAAAACTTTGTAATCCACTTTCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTAATAAAATGAGGATGCTACATTGaGGACTGGTC Macbrideina TGATAACTTTCAAATTCAGAGAAACCCCGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCGAAAAcTTCAGAAAcGGAT AcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACAACCCGACTGA ATCTGTAaTTTTTATATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGTAaTATTCAcTTGATCAAATGATTAACcTCCATAGTCTGcATAGATCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccct tatccccAAAAAGGATATTTGACcTCCCCa aAACTATa a TTAcTCCTATCCCTCTTTTCGTTAGCGGTTCAAAATCCCTTATTCATTCACTC TAa a a TTaCTCGTa a a AGAAcACCGATCTGGACGGAAATGCCaCTTa CTCTT ATCACAaAGTCTaTGTGT TatatATGATaATa Aa cCATACAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAACTACTCATACTGAAACTTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCCACTACCTAGATAAAACTTTGTAATCCACTTTCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTAATAAAATGAGGATGCTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Hippotis TGATAACTTTCAAATTCAGAGAAACCCCGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCGAAAAcTTCAGAAAcGGAT AcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACAACCCGACTGA ATCTGTAaTTTTTATATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGTAaTATTCAcTTGATCAAATGATTAACcTCCATAGTCTGcATAGATCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTCGGCAACAATGAAATTTATA Ta AAG A TCCGTCGACTTTAAAAATCGTGA GGTTaCaagtccctctatccccAAAAAGCATATTTGACcTCCCCa aAACTATa a TTAcTCCTATCCCTCTTTTCGTTAGCGGTTCAAAATCCCTTATTCATTCACTC TAa a a TTaCTCGTa a a AGAAcATCGATCTGGACGGAAATGCCaCTTa TTCTT ATCACAaAGTCTaTGTGT TatatATGATaATa Aa cCATACAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAACTACTCATACTGAAACTTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCCACTACCTAGATAAAACTTTGTAATCCACTTTGCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTAATAAAATGAGGATGCTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Emmenopterys TGATAACTTTCAAATTCAGAGAAACCCCGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCGAAAAcTTCAGAAAcGGAT AcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACAACCCGACTGA ATCTGTAaTTTTTATATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGTAaTATTCAcTTAATCAAATGATTAACcTCCATAGTCTGcATAGATCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCATATTTGACcTCCCCa aAACTATa a TTAcTCCTATCCCTCTTTTCGTTAGCAGTTCAAAATCCCTTATTCATTCACTC TAa a a TTaCTCGTa a a AGAAcATCGATCTGGACGGAAATGCCaCTTa TTCTT ATCACAaAGTCTaTGTGT TatatATGATaATa Aa cCATACAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAACTACTCATACTGAAACTTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCCACTACCTAGATAAAACTTTGTAATCCACTTTCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTAATAAAATGAGGATGCTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Elaeagia TGATAACTTTCAAATTCAGAGAAACCCCGGAATaTAAAAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa ACGAAACCa AAAa GGcTTCAGAAAGTTAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCGAAAAcTTCAGAAAcGGAT AcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACAACCCGACTGA ATCTGTAaTTTTTATATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCCTAaTATTCAcTTGATCAAATGATTAACcTCCATAGTCTGcATAGATCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGA GGTTaCaagtccctctatccccAAAAAGCATATTTGACcTCCCCa aAACTATa a TTAcTCCTATCCCTCTTTTCGTTAGCGGTTCAAAATCCCTTATTCATTCACTC TAa a a TTaCTCGTa a a AGAAcATCGATCTGGACGGAAATGCCaCTTa TTCTT ATCACAaAGTCTaTGTGT TatatATGATaATa Aa cCATACAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAACTACTCATACTGAAACTTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCCACTACCTAGATAAAACTTTGTAATCCACTTTCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTAATAAAATGAGGATGCTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Dioicodendron TGATAACTTTCAAATTCAGAGAAACCCCGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCGAAAAcTTCAGAAAcGGAT AcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACAACCCGACTGA ATCTGTAaTTTTTATATaGAAAACGGAAGAATTGGTGTGAATAGATTTCACATTGAAGAAAGAATCATAaTATTCAcTTGATCAAATGATTAACcTCCATAGTCTGcATAGATCTTTTCAAGAACTGATTa AATCAGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCATATTTGACcTCCCCa aAACTATa a TTAcTCCTATCCCTCTTTTCGTTAGCGGTTCAAAATCCCTTATTCATTCACTC TAa a a TTaCTCATa a a AGAAcATCGATCTGGACGGAAATGCCaTTTa TTCTT ATCACAaAGTCTaTGTGT TaGatATGATaATa Aa cCATACAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAACTACTCATACTGAAACTTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCCATTACCTAGATAAAACTTTGTAATCCACTTTCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTAATAAAATGAGGATGCTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Condaminea TGATAACTTTCAAATTCAGAGAAACCCCGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCGAAAAcTTCAGAAAcGGAT AcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACAACCCGACTGA ATCTGTAaTTTTTATATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCATAaTATTCAcTTGATCAAATGATTAACcTCCATAGTCTGcATAGATCTTTTCAAGAAATGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCATATTTGACcTCCCCa aAACTATa a TTAcTCCTATCCCTCTTTTCGTTAGCGGTTCAAAATCCCTTATTCATTCACTC TAa a a TTaCTCGTa a a AGAAcATCAATCTGGACAGAAATGCTaCTTa TTCTT ATCACAaAGTCTaTGTGT TatatATGATaATa Aa cCATACAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATTGAaTcAcaTAACTACTCATACTGAAACTTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCCACTACCTAGATAAAACTTTGTAATCCACTTTCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTGTAATAAAATGAGGATGCTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Warszewiczia TGATAACTTTCAAATTCAGAGAAACTCCGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCGAAAAcTTCAGAAAcGGAT AcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACAACCCGGCTGA ATCTGTAaTTTTTATATaGAAAACGGAAGAATTGGTGTGAATAGATTTCACATTGAAGAAAGAATCGTAaTATTCAcTTGATCAAATGATTAACcTCCATAGTCTGcATAGATCTTTTCAAGAACTGATTa AATCGGTCGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTCGGCAACAATGAAACTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGT a gtccctctatccccAAAAAGCATATTTGACcTCCCCa aAACTATa a TTAcTCCTATCCCTCTTTTCGTTAGCGGTTCAAAATACCTTATTCATTCACTC TAa a a TTaCTCATa a a AGAAcATCGATCTGGACGGAAATGCCaCTTa TTCTT ATCACAaAGTCTaTGTGT TatatATGATaATa Aa cCATAGAa ACTcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAACTACTCATATTGAAACTTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCCACTACCTAGATAAAACTTTGTAATCCACTTTCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTAATAAAATGAGGATGCTACATTGaGGACTGGTCGGGATAGC ChimarrhisHo TGATAACTTTCAAATTCAGAGAAACCCCGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCGAAAAcTTCAGAAAcGGAT AcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACAACCCGACTGA ATCTGTAaTTTATATATaGAAAACAGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGTAaTATTCAcTTGATCAAATGATTAACcTCCATAGTCTGcATAGATCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCATATTTGACcTCCCCa aAACTATa a TTAcTCCTATCCCTCTTTTCGTTAGTGGTTCAAAATACCTTATTCATTCACTC TAa a a TTaCTCGTa a a AGAAcATTGATCTGGACGGAAATGCCaCTTa TTCTT ATCACAaAGTCTaTGTGT TatatATGATaATa Aa cCATACAa ACTcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAACTACTCATATTGAAACTTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCCACTACCTAGATAAAACTTTGTAATCCACTTTCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTAATAAAATGAGGATGCTACATTGaGGACTGGTCGGGATAGCTCAGCTGG ChimarrhisGl TGATAACTTTCAAATTCAGAGAAACCCCGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCGAAAAcTTCAGAAAcGGAT AcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACAACCCGACTGA ATCTGTAaTTTATATATaGAAAACAGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGTAaTATTCAcTTGATCAAATGATTAACcTCCATAGTCTGcATAGATCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCATATTTGACcTCCCCa aAACTATa a TTAcTCCTATCCCTCTTTTCGTTAGTGGTTCAAAATACCTTATTCATTCACTC TAa a a TTaCTCGTa a a AGAAcATTGATCTGGACGGAAATGCCaCTTa TTCTT ATCACAaAGTCTaTGTGT TatatATGATaATa Aa cCATACAa ACTcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAACTACTCATATTGAAACTTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCCACTACCTAGATAAAACTTTGTAATCCACTTTCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTAATAAAATGAGGATGCTACATTGaGGACTGGTCGGGATAGCTCAGCTGG ChimarrhisTu TGATAACTTTCAAATTCAGAGAAACCCCGGACTaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAAAAATCTTTCCATCGAAAAcTTCAGAAAcGGAT AcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACAACCCGACTGA ATCTGTAaTTTATATATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGTAaTATTCAcTTGATCAAATGATTAACcTCCATAGTCTGcATAGATCTTTTCAAGAACTTATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTATACATGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCATATTTGACcTCCCCa aAACTATa a TTAcTCCTATCCCTCTTTTCGTTAGCGGTTCAAAATACCTTATTCATTCACTC TAa a a TTaCTCGTa a a AGAAcATCGATCTGGACGGAAATGCCaCTTa TTCTT ATCACAaAGTCTaTGTGT TatatATAATaATa Aa cCATACAa ACTcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAACTACTCATATTGAAACTTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCCACTACCTAGATAAAACTTTGTAATCCACTTTCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTAATAAAATGAGGATGCTACATTGaGGACTGGTCGGGATAGCTCAGCTGG ChimarrhisMi TGATAACTTTCAAATTCAGAGAAACCCCGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGCAATCTTTCCATCGAAAAcTTCAGAAAcGGAT AcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACAACCCGATTGA ATCTGTAaTTTATATATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGTAaTATTCAcTTGATCAAATGATTAACcTCCATAGTCTGcATAGATCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCATATTTGACcTCCCCa aAACTATa a TTAcTCCTATCCCTCTTTTCGTTAGCGGTTCAAAATACCTTATTCATTCACTC TAa a a TTaCTCGTa a a AGAAcATCGATCTGGACGGAAATGCCaCTTa TTCTT ATCACAaAGTCTaTGTGT TatatATGATaATa Aa cCATACAa ACTcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAACTACTCATATTGAAACTTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCCACTACCTAGATAAAACTTTGTAATCCACTTTCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTAATAAAATGAGGATGCTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Capirona TGATAACTTTCAAATTCAGAGAAACCCCGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCTTTAGTAGAGAAACCTTTCCATCGAAAAcTTCAGAAAcGGAT AcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACAACCCGACTGA ATCTGTAaTTTTTATATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGTAaTATTCAcTTGATCAAATGATTAACcTCCATAGTCTGcATAGATCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGATTTTTAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCATATTTGACcTCCCCa aAACTATa a TTAcTCCTATCCCTCTTTTCGTTAGCGGTTCAAAATCCCTTATTCATTCACTC TAa a a TTaCTCGTa a a AGAAcATCGATCTGGACGGAAATGCCaCTTa TTCTT ATCACAaAGTCTaTGT T TatatATGATaATa Aa cCATACAa ACTcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAACTACTCATGTTGAAACTTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCCACTACCTAGATAAAACTTTGTAATCCACTTTCCTTaaCTTTa aTAATTGACATAGAcCCCACTTTCTAATAAAATGAGGATGCTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Bathysasp TGATAACTTTCAAAGTCAGAGAAACCCCGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCGAAAAcTTCAGAAAcGGAT AcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACAACCCGACTGA ATCTGTAaTTTTTATATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGTAaTATTCAcTTGATCAAATGATTAACcTCCATAGTCTGcATAGATCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCATATTTGACcTCCCCa aAACTATa a TTAcTCCTATCCCTCTTTTCGTTAGCGGTTCAAAATCCCTTATTCATTCACTC TAa a a TTaCTCGTa a a AGAAcATCGATCTGGACGGAAATGCCaCTTa TTCTT ATCACAaAGTCTaTGTGT TatatATGATaATa Aa cCATACAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAACTACTCATACTGAAACTTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTTCACTACCTAGATAAAACTTTGTAATCCACTTTCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTAATAAAATGAGGATGCTACGTTGaGGACTGGTCGGGATAGCTCAGCTGG Calycophyllum TGATAACTTTCAAATTCAGAGAAACCCCGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCGAAAAcTTCAGAAAcGGAT AcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACAACCCGACTGA ATCTGTAaTTTTTATATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAAAATCGTAaTATTCAcTTGATCAAATGATTAACcTCCATAGTCTGcATAGATCTTTTCAAGAACTGATTa AATCGGACGAGAATTAAGATAGAGTCCCGTTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGAATATTTGACcTCCCCa aAACTATa a TTAcGCCTATCCCTCTTTTCGTTAGCGGTTCAAAATCCCTTATTCATTCACTC TAa a a TTaCTCGTa a a AGAAcATCGATCTGGACGGAAATGCCaCTTa TTCTT ATCACAaAGTCTaTGTGT TatatATGATaATa Aa cCATACAa ACTcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAACTACTCATACTGAAACTTACAAAGcTACaTCTTTT aTTAAGATaACAAGAAATTCCACTACCTAGATAAAACTTTGTAATCCACTTTCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTAATAAAATGAGGATGCTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Alseis TGATAACTTTCAAATTCAGAGAAACCCCGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACTa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCGAAAAcTTCAGAAAcGGAT AcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACAACCCGACTGA ATCTGTAaTTTTTATATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGTAaTATTCAcTTGATCAAATGATTAACcTCCATAGTCTGcATAGATCTCTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCATATTTGACcTCCCCa aAACTATa a TTAcGCCTATCCCTCTTTTCGTTAGCGGTTCAAAATCCCTTATTCATTCACTC TAa a a TTaCTCGTa a a AGAAcATCGATCTGGACGGAAATGCCaCTTa TTCTT ATCACAaAGTCTaTGTAT TatatATGATaATa Aa cCATACAa ACTcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATAATTTACAATCGAaTcAcaTAACTACTCATACTGAAACTTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCCACTACCTAGATAAAACTTTGTAATCCACTTTCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTAATAAAATGGGGATGCTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Pinckneya TGATAACTTTCAAATTCAGAGAAACCCCGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAAAAATCTTTCCATCGAAAAcTTAAGAAAcGGAT AcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACAACTCGACTGA ATCTGTAaTTTTTATATaGAAAACGGAAGAATTGGTGTAAATAGATTCCACATTGAAGAAAGAATCGTAaTATTCAcTTGATCAAATGATTAACcTCCATAGTCTGcATAGATCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTTGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCATATTTGACcTCCCCa aAACTATa a TTAcTCCTATCCCTCTTTTCGTTAGCGGTTCAAAATCCCTTATTCATTCACTC TAa a a TTaCTCGTa a a AGAAcATCGATCTGGACGGAAATGCCaCTTa TTCTT ATCACAaAGTCTaTGTGT TatatATGATaATa Aa cCATCCAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAACTACTCATACTGAAACTTACAAAGcTACaTCTTTT aTGAAGATaCCAAGAAATTCCACTACCTAGATAAAACTTTGTAATCCACTTTCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTAATAAAATGAGGATGCTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Bikkia TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa TCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCCAAAAcTTCAGAAAcGAAT GcAGGcTGcAAGGAGAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACGACTCGACGGA ATCTGTAaTTTATATATaAAAAACGGAAGAATTAATGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCAGAGTCTGcATAGTTCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCTGTTCTACATGTCAATGCCGGCAACAATGAAATTTATAG Mussaenda TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCa AAAa GGcTTCCGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCGAAAAcTGCAGAAAcAGAT AcAAGcTGcAAGGATAAA CATAcGTGAATACTAcTa aaATCAAAaTGATTa AATGACCACTCGGCTGA ATCTGTAaTTTTTATATaGAAAACGGAAGAATGGGTGTGAATAGATTCCACATTGAAGAAAGAATCGAAaCATTCAcTTGATCAAATGATTCACcTCCAGAGTCTGcATAGATCGTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTCAGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCGTATTTGACcTCCCCa aAACTATa a TTAcTCCTATCCCTCTTTTTGTTAGCGGTTCAAAATCCCTTATTCATTCACTC TAa a a TTaCTCTTa a a AGAAcAGAGATCTGGACGGAAATGATaCTTa TTCTT ATCACAcAGTCTaTGTGT TatatATGATaATa Aa cCATACAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAACTACTCATACTGAAACTTCCAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCCAGTACCTAGATAAAACTTTAGAATTCCTTTCCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTCATAAAATGAGGATGCTACGTTGaGGACTGGTCGGGATAGCTCAGCTGG Dolichodelphys a tctatccccAAAAAGCATATTTGACcTCCCCa aAACTATa a TTAcTCCTATCCCTCTTTTCGTTAGCGGTTCAAAATCCCTTATTCATTCACTC TAa a a TTaCTCGTa a a AGAAcATCGATCTGGACGGAAATGCCaCTTa TTCTT ATCACAaAATCTaTGTGT TatatATGATaATa Aa cCATACAa ACTcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAACTACTCATATTGAAACTTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCCACTACCTAGATAAAACTTTGTAATCCACTTTCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTAATAAAATGAGGATGCTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Pseudomussaenda a ccctctatccccAAAAAGCGTATTTGACcTCCCCa aAACTATa a TTAcTCCTATCCCTCTTTTTGTTAGCGGTTCAAAATCCCTTATTCATTCACTC TAa a a TTaCTCTTa a a AGAAcATCGATCTGGACGGAAATGATaCTTa TTCTT ATCATAcAGTCTaTGT T TCtatATGATaATa Aa cCATACAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGACTGATTTACAATCGAaTcAcaTAATTACTCATACTGAAACTTCCAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCCAGTACCTAGATAAAACTTTAGAATCCCTTTCCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTCATAAAATGAGGATGCTACGTTGaGGACTGGTCGGGATAGCTCAGCTGG Retiniphyllum TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATTCTGAGCCAAATCCTATTTTa CCGAAACCa AAAa AAAAGGCTAGGTGCAGAGACTCAACGGAAGCTATTCTAACAAATGGAGTTGGCTGCATTAGTAAAGAAATCCTTACATCGAAAAcTTCAGAAAcGRGT AcAAGcTAcAAGGATAAA CGTAcTTTAATACTAcTa aaATCAAAaTGATTa AATGACGGCTCAACTTA ATTTGTAaTTTTTATATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGCAGAAAGAGTCAAAaTATTCAcTTGATCAAATGATTTACcTCCACAGTCTGcATAGATCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCTGTTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGA GGTTaCaagtccctctatccccAAAAAGCATATTTGAAcCCCCCa aAACTATa a TTGcTCCTATCCCTCTTTTCATTAGCGGTTCAAAATCCCTTATTAATTTACTC TAa a a TTaCTCTTa a a AGAGcATCGATCTGGACGGAAAAGCCaACTa TTCTT ATCACAaAATGTaTGTGT TatatATGATaATa Aa cCATACAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTACCCATTTGACTGATTTACAATCGAaTcAcaTAACTACTCATACTGAAACTTATAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCCAGTACCTAGATAAATTTTTATAATCCCCTTACCTTaaCTTTa aTAATTGACATAACcCCCCTTT CTCATAAAATGAGAATGCTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Vangueria TGCTAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCGATGGAAGTTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAAAGAAATCTTTCCATCGAAAAcTTCCGAAAcGGAT McAAAa CGTAcTTCAATACTAcTa aaATCAAAaTGATTa AATGACGACTCGACTGA ATCCGTAaTTTTTATATaGAAAACGGAAGAGTTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATTAAATGATTCACcTCCATAGTCTGcATAGATCTTTTCAAGAATTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTG GGTTaCaagtccctctatccccAAAAAGCATATTTGACcCCTCCa aAACTATa a TTAcTCCTATCTCCCTTTTCATTAGCGGTTCAAAATACCTTATTCATTTACTC TAa a a TTaCTCTTa a a AGAAcATCGATCTGGACGAAAAAGCCaCTTa TTCTT ATCACAaAATGTaTGTGT TatTtATGATaATa Aa a AAcCaATCTTTa AcGAAAcTCCCCATTTGAATGCTTTACAATCGAaTcAcaTAACTACTCATCCTGAAACTTACAAAGcTACaT GATaCCAAGCAATTCTAGTACCTAGATAAAACTTTGTAATCCCTTTTCCTTaaCTTTa aTAATTGACATAGCcCACTTTTTCTCATAAAATGAGTATGCTACATTGaGGGCTGGTCGGGATAGCTCAGCTGG Keetia TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCGAAAAcTTCCGAAAcGGAT AcAAAa CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACGACTCGACTGA ATCTGTAaTTTTTATATaGAAAATGGAAGAATTGGTGTGACTAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATTAAATGATTCACcTCCATAGTCTGcATAGATCTTTTCAAGAATTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGT aCaagtccctctatccccAAAAAGCATATTTGACcCCCCCa aAACTATa a TTAcTCCTATCCCCCTTTTCATTAGCAGTTCAAAATACCTTATTCATTTACTC TAa a a TTaCTCTTa a a AGAAcATCGATCTGGACGAAAAAGCCaCTTa TTCTT ATCACAaAATCTaTGTGT TatTtATGATaATa Aa a AAcCaATCTTTa AcGAAAcTCCCCATTTGAATGCTTTACAATCGAaTcAcaTAACTACTCATCCTGAAACTTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCTAGTACCTAGATAAAACTTTGTAATCCCCTTTCCTTaaCTTTa aTAATTGACATAGCcCACTTTTTCTCATAAAATGAGGATGCTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Canthium TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCGAAAAcTTCCGAAAcGGAT AcAAAa CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACGACTCGACTGA ATCTGTAaTTTTTATATaGAAAATGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATTAAATGATTCACcTCCATAGTCTGcATAGATCTTTTCAAGAATTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTT AAATCGTGA GGTTaCaagtccctctatccccAAAAAGCATATTTGACcCCCCCa aAACTATa a TTAcTCCTATCCCCCTTTTCATTAGCGGTTCAAAATACCTTATTCATTTACTC TAa a a TTaCTCTTa a a AGAAcATCGATCTGGACGAAAAAGCCaCTTa TTCTT ATCACAaAATCTaTGTGT TatTtATGATaATa Aa a AAcCaATCTTTa AcGAAAcTCCCCATTTGAATGCTTTACAATCTA AcA CCCTTTCCTTaaCTTTa aTAATTGACATAGCcCACTTTTTCTCATAAAATGAGGATGCTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Greenea ACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCa AAAa GGcTACAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCGAAAAcTTCCGAAAcGGAT AcAAGcTGcAAAGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACGACTCGACTGA ATCTGTAaTTTTTATATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATTAAATGATTCACcTCCATAGTCTGcATAGATCTTTTCAAGAATTGATTa AATCGGACGAGAATAAAGATAGAGCCCTGTTATACATGTCAATGTTGGCAACAATGAAATTT a aagtccctctatccccAAAAAGCTTATTTGACa CCCCa aAATTATa a TTAcTCCTATCCCCCTTTTCATTAGCGGTTCAAAATACCTTATTCATTTACTC TAa a a TTaCTCTTa a a AGAAcATCGATCTGGACGAAAAAGCCaCTTa TTCTT ATCACAaAATCTaTGTGT TatTtATGATaATa Aa a AAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGGTTTACAATCGAaTcAcaTAACTACTCATACTGAAACTTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCGAGTACCTAGATAAAACTTTGTAATCCCTTTTCCTTaaCTTTa aTAATTGACAAAGCcCCCTTTTTCTCATAAAATGAGGATGCTACATTGaGTACTGGTCGGGATAGCTCAGCTGG Aleisanthiopsis TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCa AAAa GGcTACAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCGAAAAcTTCCGAAAcGGAT AcAAGcTGcAAAGATAAA GGTAcTTGAATACTAcTa aaATCAAAaTGACTa AATGACGACTCGACTGA ATCTGTAaTTTTTATATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATTAAATGATTCACcTCCATAGTCTGcATAGATCTTTTCAAGAATTGATTa AATCGGACGAGAATAAAGATAGAGCCCCGTTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGG a cctctatccccAAAAAGCATATTTGACa CCCCa aAACTATa a TTAcTCCTATCCCCCTTTTCATTAGCGGTTAAAAATACCTTATTCATTTACTC TAa a a TTaCTCTTa a a AGAAcATCGATCTGGACGAAAAAGCCaCTTa TTCTT ATCACAaAATCTaTGTGT TatTtATGATaATcTAa a AAcTaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAGTGGTTTACAATCGAaTcAcaTAACTACTCATACTGAAACTTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCTAGTACCTAGATAAAACTTTGTAATCCCCCTTCCTTcaCTTTa aTAATTGACAAAGCcCCCTTTTTCTCATAAAATGAGGATGCTACATTGaGTACTGGTCGGGATAGCTCAGCTGG Ixora TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCa AAAa GGcTACAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGTTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCGAAAAcTTCCGAAA AGcTGcAAAGATAAA GGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACGACTCGACTGA ATCCGTAaTTTTTATATaGAAAAGGGAAGAATTGGTGTGAATAGATTCCACATTAAAGAAAGAATCGAAaTATTCAcTTGATTAAATGATTCACcTCCATAGTCTGcATAGATCTTTTCAAGAATTGATTa AATCGGACGAGAATAAAGATAGAGCCCCGTTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGG a ccctctatccccAAAAAGCATATTTGACcCCCCCa aAACTATa a TTAcTCCTATCCCCCTTTTCATTAGCGGTTCAAAATACCTTATTCATTTATTC TAa a a TTaCTCTTa a a AGAAcAGAGATCTGGACGAAAAAGCCaCTTa TTCTT ATCACAaAATCTaTGTGT TatTtATGATaATcTAa a AAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGGTTTACAATCGAaTcAcaTAACTACTCATACCGAAACTTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCTAGTACCTAGATAAAACTTTGTAATCCCCTTTCCTTaaCTTTa aTAATTGACAAAGCcCCCTTTTTCTCATAAAATGAGGATGCTACGTTGaGTACTGGTCGGGGTAGCTCAGCTGG Aleisanthia TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCa AAAa GGcTACAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTTCGTTAGTAGAGAAATCTTTCCATCGAAAAcTTCCGAAAcGGAT AcAAGcTGcAAAGATAAA GGTAcTTGAATACTAcTa aaATCAAAaTGACTa AATGACGACTCGACTGA ATCTGTAaTTTTTATATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATTAAATGATTCACcTCCATAGTCTGcATAGATCTTTTCAAGAATTGATTa AATCGGACGAGAATAAAGATAGAGCCCCGTTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAA TCCGTCGACTTTAAAAATCGTGAGGG a ccctctatccccAAAAAGCATATTTGACa CCCCa aAACTATa a TTAcTCCTATCCCCCTTTTCATTAGCGGTTAAAAATACCTTATTCATTTACTC TAa a a TTaCTCTTa a a AGAAcATCGATCTGGACGAAAAAGCCaCTTa TTCTT ATCACAaAATCTaTGTGT TatTtATGATaATcTAa a AAcTaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGGTTTACAATCGAaTcAcaTAACTACTCATACTGAAACTTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCTAGTACCTAGATAAAACTTTGTAATCCCCCTTCCTTcaCTTTa aTAATTGACAAAGCcCCATTTTTCTCATAAAATGAGGATGCTACATTGaGTACTGGTCGGGATAGCTCAGCTGG Wendlandia TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAACAAAAAcGGGGCAATCCTGAGCCAAATCCCGTTTTa CCGAAACCa AAAa GGcTTCATAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGATAAATCTTTCCATCTAAAAcTTCCGAAAcGGAT AcAAGcTGcAAGGATAAA CATAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACAACTCCACTGA ATCTGTAaTTTTTATATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCTGcATAGATCTTTTCAAGAATTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAATCATATTTGACcCCCCCa aAACTATa a TTAcTCCTATCCCC TTTTCATTAGCGGTTCAAAATACCTTATTCATTTACTC TAa a a TTaTTCTTa a a AGAAcATCGATCTGCACGGAAAAGCCaCTTa TTCTT ATCACAaAATCTaTGTGT TatTtATGATaATa Aa cCATACAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTACCCATTTGAATGGTTTACAATCGAaTcAcaTAACTACTCATACTGAAACTTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCTAGTACCTAGATAAAACTTTGTAATCCCCTTTCCTTaaCTTTa aTAATTGACATAGCcCCCTTTTTCTCATAAAATGAGGATGCTACATTGaGGACGGGTCGGGATAGCTCAGCTGG Lindenia TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCCGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAAAAATCTTTCCATCTAAAAcTTCCGAAAcGGAT AcAAGcTGcAAGGATAAA CTTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACGACTCGAATGA ATCTGTAaTTTTTATATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAAATGATTAACcTCCATAGTCTGcATAGATCTTTTCAAGAATTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTCGGCAACAATTAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTGAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAACATATTTTACcCCCCCa aAACTATa a TTAcTCCTATCCCC TTTTCGTTAGCGGTTCAAAATACCTTATTCATTTACTC TAa a a TTaTTCTTa a a AGAAcATCGATCTGGACGGAAAAGCCaCTTa TTCTT ATAAAAaAATCTaTGTGT TatTtATGATaATa Aa cCATACAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTACCCATTTGAATGGTTTACAATCGAaTcAcaTAACTACTCATACTGAAACTTACAAAGcTACaTCTTTT aTTAAGATaCCAAAAAATTATAGTACCTCTATAAAACTTTTTAATCCCCTTTCCTTaaCTTTa aTAATTGACAGAGCcCCCTTTTTCTCATAAAATGAGGATGCTACATTGaGGACGGGTCGGGATAGCTCAGCTGG Augusta TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCCGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGATAAATCTTTCCATCTAAAAcTTCCGAAAcGGATTAcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACGACTCGAATGA ATCTGTAaTTTTTTTATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCTGcATAGATCTTTTCAAGAATTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTCAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAACATATTTGACcCCGCCa aAACTATa a TTAcTCCTATCCCTCTTTTCGTTAGCGGTTCAAAATACCTTATTCATTTACTC TAa a a TTaTTCTTa a a AGAAcATCGATCTGGACGGAAAAGCCaCCTa TTCTT ATCACAaAATCTaTGTGT TatTtATGATaATa Aa cTATACAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcAACCCATTTGAATAGTTTACAATCGAaTcAcaTAACTACTCATACTGAAACTTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCTAGTACCTAGATAAAACTTTGTAATCCCCTTTCCTTaaCTTTa aTAATTGACAGAGCcCCCTTTTTCTCATAAAATGAGGATGCTACATTGaGGACGGGTCGGGATAGCTCAGCTGG Randia TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCCGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCTAAAAcTTCCGAAAcGGAT AcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACGACTCGACTGA ATCTGTAaTTTTTATATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAGGAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCTGcATAGATCTTTTCAAGAATTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAACATATTTGATcCCCCCa aAACTATa a TTAcTCCTATCTCC TTTTCGTTAGCGGTTCAAAATACCTTATTCATTTACTC TAa a a TTaCTCTTa a a AGAAcATCGATCTGGACGGAAAAGCCaCTTa TTCTT ATCACAaAATCTaTGTGT TatTtATGATaATa Aa cCATATAa AATa cGAGcCAAcGAAAcTATCCATTTGAATGGTTTACAATCGAaTcAcaTAACTACTCATACTGAAACTTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCTAGTACCTAGATAAAACTTTGTAATCCCCTTTCCTTaaCTTTa aTAATTGACATAGCcCCCTTTTTCTCATAAAAKGAGGATGCTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Genipa TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCCGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCTAAAAcTTCCGAAAcGGAT AcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACGACTCGACTGA ATCTGTAaTTTTTATATaGAAAACGGAAGAATTGGTGTGAATCGATTCCACAT AAAGAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCTGcATAGATCTTTTCAAGAATTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAATATATTTGATcCCCCCa aGACGATa a TTAcTCTTATCCCC TTTTCGTTAGCGGTTCAAAATACCTTATTCATTTACTC TAa a a TTaCTCTTa a a AGAAcATCGATCTGGACAGAAAAGCCaCTTa TTTTT ATCACAaAATCTaTGTGT TatTtATGATaATa Aa cCATATAa AATa cGAGcCAAcGAAAcTACCCATTTGAATGGTTTACAATCGAaTcAcaTAACTACTCATACTGAAACTTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCTAGTACCTAGATAAAACTTTGTAATCCCCTTTCCTTaaCTTTa aTAATTGACATAGAcCCCTTTTTCTCATAAAATGAGGATGCTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Gardenia TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATTCTGAGCCAAATCCCATTTTa CCGAAACCa AAAa GG TGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTAGTAGAGAAATCTTTCCATCGAAAAcTTCCGAAAcGTAT AcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACGACTCGACTGA ATCTGTAaTTTTTATATaGAAAACGGAAGAG AATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCTGcATAGATCTTTTCAAGAATTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAATATATTTGATcCCCCCa aAACTATa a TTAcTCCTATCCCC TTTTCGTTAGCGGTTCAAAATACCTTATTCATTTACTC TAa a a TTaCTCTTa a a AGAAcATCAATCTGGACGGAAAAGCCaCTTa TTCTT ATCACAaAATCTaTGTGT TatTtATGATaATa Aa cCATATAa AATa cGAGcCAAcGAAAcTACCCATTTGAATGGTTTACAATCGAaTcAcaTAACTACTCATACTGAAGCTTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCTAGTACCTAGATAAAACTTTGTAATCCCCTTTCCTTaaCTTTa aTAATTGACATAGAcCCCTTTTTCTCATAAAATGAGGATGCTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Duroia TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCCGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCTAAAAcTTCCGAAAcGGAT AcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACGACTCGACTGA ATCTGTAaTTTTTATATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCTGcATAGATCTTTTCAAGAATTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAACATATTTGATcCCCCCa aAACTATa a TTAcTCCTATCCCC TTTTCGTTAGCGGTTCAAAATACCTTATTCATTTACTC TAa a a TTaCTCTTa a a AGAAcATCGATCTGGACGGAAAAGCCaCTTa TTCTTGATCACAaAATCTaTGTGT TatTtATGATaATa Aa cCATATAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTACCCATTTGAATGGTTTACAATCGAaTcAcaTAACTACTCATACTGAAATTTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCTAGTACCTAGATAAAACTTTGTAATCCCCTTTCCTTaaCTTTa aTAATTGACATAGTcCCCTTTTTCTCATAAAATGAGGATGCTACGTTGaGGACTGGTCGGGATAGCTCATCTGG Tarenna TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCCGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTAGTAGAGAAATCTTTCCATCTAAAAcTTCCGAAAcGGGT AcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaGTCAAAaTGATTa AATGACGACTCGACTGA ATCTGTAaTTTTTATATaGAAAACGGAAGAATTGGTGTAAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCTGcATAGATCTTTTCAAGAATTGATTa AATCGGACGAGAATAAAGATAGAGTCCTGTTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAACATATTTGATcCCCCCa aAACTATa a TTAcTCCTATCCCC CTTTCGTTAGCGGTTCAAAATACCTTATTCAGTTACTC TAa a a TTaCTCTTa a a AGAAcATCGATCTGGACGGAAAAGCCaCTTa TTCTT ATCACAaAATCTaTGTGT TatTtATGATaATa Aa cCATAWAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTACCCATTTGAATGGTTTACAATCGAaTcAcaTAACTACTCATACTGAAACTTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCTAGTACCTAGATAAAACTTTGTAATCCCCTTTCCTTaaCGTTa aTAATTGACATAACTCCCATTTTCTCATAAAATGAGGATGCTACATTGaGGGCTGGTCGGGATAGCTCAGCTGG Pavetta TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCCGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCTAAAAcTTCCGAAAcGGGT AcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACGACTCGACTGA ATCCGTAaTTTTTATATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCTGcATAGATCTTTTCAAGAATTGATTa AATCGGACGAGAATAAAGATAGAGTCCTGTTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAACATATTTGATcACCCCa aAACTATa a TTAcTCCTATCCCC CTTTCGTTAGCGGTTCAAAATACCTTATTCATTTACTC TAa a a TTaCTCTTa a a AGAAcATCGATCTGGACGGAAAAGCCaCTTa TTCTT ATCACAaAATCTaTGTGT TatTtATGATaATa Aa cCATAAAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTACCCATTTGAATGGTTTACAATCGAaTcAcaTAACTACTCATACTGAAACTTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCTAGTACCTAGATAAAACTTTGTAATCCCCTTTCCTTaaCTTTa aTAATTGACATAACTCCCATTTTCTCATAAAATGAGGATGCTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Tricalysia TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCCGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCTAAAAcTTCCGAAAcGGAT AcAAGcTGcAAGGATAAA CGTAcCTGAATACTAcTa aaATCAAAaTGATTa AATGACGACTCGACTGA ATCTGTAaTTTTTATATaAAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCTGcATAGATCTTTTCAAGAATTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa a tccctctatccccAAAAAACATATTTGATcCCCCCa aAACTATa a TTAcTCCTATCCCC CTTTCGTTAGCGGTTCAAAAAACCTTATTCATTTACTC TAa a a TTaCTCTTa a a AGAAcATCGATCCGGACGGAAAAGCCaCTTa TTCTT ATCACAaAATCTaTGTGT TatTtATGATaATa Aa cCATATAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTACCCATTTGAATGGTTTACAATCGAaTcAcaTAACTACTCATACTGAAACTTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCTAGTACCTAGATAAAATTTTGTAATCCCCTTTCCTTaaCTTTa aTAATTGACATAGCcCCCATTT CTCATAAAATGAGGATGCTACATTGaGGACTGGTCGGGATAGCTCAGATGG Coffea TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCCGTTTTa CCGAAACCcAAAGG AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCTAAAAcTTCCGAAAcGGAT AcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATTAAAaTGATTa AATGACGACTCAACTGA ATCTGTAaTTTTTATATaAAAAATGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCTGcATAGATCTTTTCAAGAATTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAACATATTTGATcCCCCCa aAACTATa a TTAcTCCTATCCCC CTTTCGTTAGCGGTTCAAAAAACCTTATTCATTTACTC TAa a a TTaCTCTTa a a AGAAcATCGATCTGGACGGAAAAGCCaCTTa TTCTT ATCACAaAATCTaTGTGT TatTtATGATaATa Aa cCATATAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTACCCATTTGAATGGTTTACAATCGAaTcAcaTAACTATTCATACTGAAACTTACAAAGcTACaTCTTTT aTTAAGATaACAAGAAATTCTAGTACCTAGATAAAATTTTGTAATCCCCTTTCCTTaaCTTTa aTAATTGACATAGCcCCCCTTTTCTCATAAAATGAGGATGCTACATTGaGGACTGGTCGGGATAGCTCAGATGG Bertiera TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCCGTTTTa CTGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTTCATCTAAAAcTTCCGAAAcGGAT AcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACGACTCGACTTA ATCTGTAaTTTTTATATaAAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCTGcATAGATCTTTTCAAGAATTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa AGAGGAA CC CGAC TT a tccctctatccccAAAAAACATATTTGATcCCCCCa aAACTATa a TTAcTCCTATCCCC TTTTCGTTAGCGGTTCAAAATACCTTATTCATT ACTC TAa a a TTaCTCTTa a a AGAAcATCGATCTGGACGGAAAAGCCaCTTa TTCTT ATCACAaAATCTaTGTGT TatYtATGATaATa Aa cCATATAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTACCCATTTGAATGGTTTACAATCGAaTcAcaTAACTACTCATACTGAAACTTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCTAGTACCTAGATAAAACTTTGTAATCCCCTTTCCTTaaCTTTa aTAATTGACATAGCcCCCATTTTCTCATAAAATGAGGATGCTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Didymosalpinx ACTTTCAAATTCAGAGAAACCCTGGAATaTAATGAAAAcGGGGCAATCCTGAGCCAAATCCCGTTTTa TCGAAACCa AAAa GGcTTCAGACTGTGAATAGGATAGGTGCAGAGACTCAACGGAAGCTGT CTAACAAATGGATTTGGCTGCGTTAGTAGA AAATCTTTCCATCTAAAAcTTCCGAAAc GAT AcAAGcTGcAAGTATAAA CGTAcTTGAATACWAcTa aaATCAAAaTGATTa AATGACGACTCGACTGA ATCTGTAaTTTTTAT TaGAAAACGGAAGAATTGGTGTGGATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATC AACGATTCACcTCCATAGGCTGcATAGATCTTTTCAAGAATTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGA a ccccAAA AACATATCTGATcCCCCGa aAACTATa a TTAcTCCTATCCCC TTTTCGTTAGCAGTTCAAAATACCTTATTCATTTACTC TAa a a TTaCTCTTa a a AGAAcATCGATCGGGACAGAAAAGCCaCTTa TTCTT ATCACAaAATCTaTGTGT TatTtATGATaATa Aa cCATATAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTACCCATTTGAATGGTTTCCAATCGAaTcAcaTAACTACTCATACTGAAACTTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCTAGTACCTAGATAAAACTTTGTAATTCCCTTTCCTTaaCTTTa aTAATTGACATAGCcCCCTTTTTCTCATAAAATGAGGATGCTACATTGaGGACTAGTCGGGATAGCTCAGCTGG Paragenipa TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCCGTTTTa CCGAAACGcAAACC AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCTAAAAcTTCCGAAAcGGAT AcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACGACTCAACTGA ATCTGTAaTTTTTATATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCTGcATAGATCTTTTCAAGAATTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAACATATTTGATcCCCCCa aAACTATa a TTAcTCCTATCCCC TTTTCGTTAGCGGTTCAAAATACCTTATTCATTTACTC TAa a a TTaCTCTTa a a AGAAcATCGATCTGGACAGAAAAGCCaCTTa TTCTT ATCACAaAATCTaTCTGT TatTtATGATaATa Aa cCATATAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTACCCATTTGAATGGTTTACAATCGAaTcAcaTAACTACTCATACTGAAACTTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCTAGTACCTAGATAAAACTTTGTAATTCTCTTTCCTTaaCTTTa aTAATTGACATAGCcCCCTTTTTCTCATAAAATGAGGATGCTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Maguireothamnus AACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa CGGAAACCcAAAGC AAAa GGcTTCAGAAAGTAAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCAAAAAcTCCAGAAAcGGAT AcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa caATCAAAaTGATTa AATGACGACCCGACTTA ATCTGTAaTTTTTATATaGAAAACGGACGAATTGGTGTGATTAGATTCCACATTGAAGAAAGAATCGAAcTATTCAcTTGATCAACTGATTCACcTCCATAGTCTGcATAGATCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATCTCAATGTCGGCAACAGTGAAATTTATA Ta A A GAAAATCCGTCGACTTTAAAAATCGTGA GGTTaCaagtccctctatccccAAAAAGCATATTTGACcTCCCCa aAACTATa cATTAcTCCTATCCCTCTTTTCGTTAACGGTTCAAAATCCCTTATTCATTCACTC CAa a a TTaCTCTTa a a AGAAcATCGATCTGGACAGAAGTGACaCTTa TTCTT ATCCCAaAGTCTaTGTGT TatatATGATaATa Aa cCATAGAa AATcGAAcCaATCTTTcGAGcCAGcTAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAACTACTCATACTGAAACTTACAAAGcTACaTCTTGG aTTAAGATaCCAAGAAATTCCAGTACCTAGATAAAACTTTGTAATCCCCTTTCCTTaaTTTTa aTAATTGACATAGAcCCCATTTTCTAATAAAATGAGGATGCTACATTGaGGACTGGTCGGGATAGCTCAGTTGG Sipaneabif TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCcAAAGC AAAa GGcTTCAAAAAGTAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGGTGGCTGTGTTAGTAGAGAAATCTTTCCATCGAAAAcTTCAGAAAa GGATAAA CGTAcTTGAATACGAcTa caATCAAAaTGATTa AATGACGACTCGACTTA ATCTGTAaTTTTTATATaGAAAACGGAAGAGTTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAACTGATTCACcTCCATAGTCTGcATAGATCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCATAGTTGACcTCCCCa aAACTACa a TTAcTCCTATCCCTCTTTTCGTTAACGGTTCAAAATCCCTTATTCATTCACTC TAa a a TTaCTCTTa a a AGAAcATTGATCTGGACAGAAATGCCaCTTa TTCTT ATCACAaAGTTTaTGTGT TatatATGATaATa Aa cCATAGAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCAAaTcAcaTAACTATTCATACTGAAACTTACAAAGcTATaTCTTGG aTTAAGATaCCAAGAGATTCCAGTACCTAGATAAAATTTTGTAATCCCCTTTCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTAATAAAATGAGGATGCTACATTGaGGACTGGTCGGGATAGCTCAGTTGG Sipaneabel TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCcAAAGC AAAa GGcTTCAGAAAGTAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGGTGGCTGTGTTAGTAGAGAAATCTTTCCATCGAAAAcTTCAGAAAa GGATAAA CGTAcTTGAATACGAcTa caATCAAAaTGATTa AATGACGACTCAACTTA ATCTGTAaTTTTTATATaGAAAACGGAAGAGTTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAACTGATTCACcTCCATAGTCTGcATAGATCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCATATTTGACcTCCGCa aAACTACa a TTAcTCCTATCCCTCTTTTCGTTAACGGTTCAAAATCCCTTATTCATTCACTC TAa a a TTaCTCTTa a a AGAAcATTGATCTGGACAGAAATGCCaCTTa TTCTT ATCACAaAGTTTaTGTGT TatatATGATaATa Aa cCATAGAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAACTATTCATACTGAAACTTACAAAGcTACaTCTTGG aTTAAGATaCCAAGAGATTCCAGTACCTAGATAAAATTTTGTAATCCCCTTTCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTAATAAAATGAGGATGCTACATTGaGGACTGGTCGGGATAGCTCAGTTGG Sipaneas TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAGcGGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCcAAAGCaAAAa GGcT CAGAAAGTAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTGTTTTAGTAGAAAAATCTTTCCATCGAAAAcTTCAGAAAa GGATAAA CGTAcTTGAATACGAcTa caATCAAAaTGATTa AATGACGACCCGACTTA ATCTGTAaTTTTTATATaGAAAACAGAAGAGTTGGTGTGAATAGATTCCACATTGCAGAAAGAATCGAAaTATTCAcTTGATCAACCGATTCACcTCCATAGTCTGcATAGATCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCATATTTGACcTCCCCa aAACTACa a TTAcTTCTTTCTCTCTTTTCGTTAACGGTTCAAAATCCCTTATTCATTCACTC TAa a a TTaCTCTTa a a AGCAcATTCATCTGGACAGAAATGCCaCTTa TTCTT ATCACAaAGTTTaTGTGT TatatAGGATaATa Aa cCAGAGAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcCcaTAACTATTCATACTGAAACTTACAAAGcTACaTCTTGG aTTAAGATaCCAAGAGATTCCAGTACCTAGATAAAATTTTGTAATCCCCTTCCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTAATAAAATGAGGATGCTACATTGaGGACTGGTCGGGATAGCTCAGTTGG Sipaneopsis TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCcAAAGC AAAa GGcTTCAGAAAGTAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTATGTTAGTAGAGAAATCTTTCCATCGAAAAcTTCAGAAAcGGAT AcAAGcTGcAAGGGTAAA CGTAcTTGAATACTAcTa caATCAAAaTGATTa AATGACGACCCGACTTA ATCTATAaTTTTTATCTaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAACTGATTCACcTCCATAGTCTGcATAGATCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACGTGTCAATGTCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGTATATTTGACcTCCCCa aAACTATa a TTAcTCCTATCCCTCTTTTCGTTAGCGGTTCAAAATCCCTTATTCATTCACTC TAa a a TTaCTCTTa a a AGAAcATTGATCTGGGCGGAAATGCCaCTTa TTCTT ATCACAaAGTCTaTATGT TatatATCATaATa Aa cCATAGAa AATcGAAcCcATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAACTATTCAGACTGAAACTTACAAAGcTACaTCTTGG aTTAAGATaCCAAGAGATTCCAGTACCTAGATAAAACTTTGTAATCCCCTTTCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTAATAAAATGAGGAGGCTACATTGaGGACTGGTCGGGATAGCTCAGTTGG Neobertiera GGGCAATC TGAGCCAAATCCTGTTTTa CCGAAACCcAAAGT AAAa GGcTTCAGAAAGTAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTGTTCTAACAAATGGAGTTGGCTATGTTAGTAGAGAAATCTTTCCATCGAAA cTTCAGAAAcGGAT AcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa caATCAAAaTGATTa AATGACGACCCGACTTA ATCTGTAaTTTTTATATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGA CAACTGATTCACcTCCATAGTCTGcATAGATCTTTTCAAGAACTGATTa TATCGGACGAGAATAAAGATAGAGTCCCGCTCTACGTGTCAATGTCGGCAACAATGAAATTTATAGTa TAGAGGGAAATC a aagtccctctatccccAAAAAGTATATTTGACcTCCCCa aAACTATa a TTAcTCCTATCCCTCTTTTCGTTAACGGTTCAAAATCCCTTATTCATTCACTC TAa a a TTaCTCTTa a a AGAAcATTGATCTGGGCGGAAATGCCaCTTa TTCTT ATCACAaAGTCTaTGTGT TatatATCATaATa Aa cCATAGAa AATcGAAcCcATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAACTATTCAGACTGAAACTTACAAAGcTACaTCTTGG aTTAAGATaCCAAGAGATTCCAGTACCTAGATAAAACTTTGTAATCCCCTTTCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTAATAAAATGAGGAGGCTACATTGaGGACTGGTCGGGATAGCTCAGTTGG Posoqueria TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCCGTTTTa CCGAAACCa AAGa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGATGTTCTAACAAATGGAGTTGGCTGCATTAGTAGAGAAATCTTTCCATCGAAAAcTTCAGAAAcGGAT AcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACGACCCAACTGA ATCTGTAaTTTTTATATaGAAAATGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCTGcATAGATCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTCGGCAATAATGAAATTTATAGTa AAGAGGAAAATCCCTCGACTTTAAAAATCGTGAGGGTTaCa tccctctatccccAAAAAGCATATTTGACcTCCCCa aAACTATa a TTCcTCCTATCCCTCTTTTCGTTAACGATTCAAAATCCCTTATTCATTCACTC TAa a a TTaCTCTTa a a AGAAcATAGATCTGGACAGAAATGCCaCTTa TTCTT ATCACAaAGTCTaTGTGT TatatACGATaATa Aa cCATACAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAACTACTCATACTGAAACTTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCCAGTACCTAGATAAAACTTTGTAATCTCCTTTCCTTaaCTTTa aTAATTGACATAGATCCCATTTTCTAATAAAATGAGGATGCTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Molopanthera TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCCGTTTTa CCGAAACCa AAGa GGcTTCAAAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGATGTTCTAACAAATGGAGTTGGCTGCGTTAGTA AGAAATTTTTCCATCGAAAAcTTCAGAAAcGGAT AcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACGACCCAACTTA ATCTGTAaTTTTTATATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCTGcATAGATCTTTTCAAGAACTGATTa ATCCGGACGAGAATAAAGATA AGTCCCGTTCTACATGTC ATGTC GCAACAATGAAATTTATAGTa AAGA GAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCATATTTGACcTCCCCa aAACTATa a TTCcTCCTATACCTCTTTTCGTTAACGATTCAAAATCCCTTATTCATTGACTC TAa a a TTaCTCTTa a a AGAAcATCGATCGGGACAGAAATGCCaCTTa TTCTT ATCACAaAGTCTaTGTGT TatatACGATaATa Aa cCATACAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAACGACTCATACTGAAACTTACAAAGcTACaTCTGTGTaTTAAGATaCCAAAAAAATCTAGTACCTGGATAAAACTTTGTAATCCCCCTTCCTTaaCTTTa aTAATTGACATAGATCCCATTTTCTAATAAAATGAGGATGCTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Gleasonia TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCCGTTTTa CCGAAACCa AAAa GGcTTCATAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGATGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCGAAAAcTTCAGAAAcGGAT AcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACGACCCAACTGA ATCTGTAaTTTTTATATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCTGcATAGATCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGTCGGCAACAATGAAATTTATATTa AAGAGGAAAATCCGTCGACTTTCAAAATCGTGA GGTTaCaagtccctctatccccAAAAAGCATATTTGACcTCCCCa aAACTATa a TTAcTCCTATCCCTCTTTTCGTTAACGGTTCAAAATCCCCTATTCATTCACTC TAa a a TTaCCCTTa a a AGAAcATCGATCTGGACAGAAATGCCaCTTa TTCTT ATCACAaAGTCTaTGTGT TatatATGATaATa Aa cCATACAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTAGAATCGAaTcAcaTAACTACTCATACTGAAACTTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCCAGTACCTAGATAAAACTTTGTAATCCCCTTTCCTTaaCTTTa aTAATTGACATAGATCCCATTTTCTAATAAAATGAGGATGCTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Ladenbergia TGATAACTTTCAAATTCAGAGAAACCCTGGAATcTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCGAAAAcTTCAGAAAcGACT GcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACGAAACAACTGA ATCTGTAaTTTATATATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAGTCAAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCTGcATAGATCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGCCTGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCCTATTTGACcTCCCCa aAACTATa a TTAcTCCTATCCTTCTTTTCATTAGCGGTTCAAAATTCCTTAGCCATTCACCC TAa a a TTaCTCTTa a a AGAAcATCGATCTGGGCGGAAATGCCaCTTa TTCTT ATCACAaAGTCTaTGT TatatATGATaATa Aa cCATACAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGA TcAa CATACTGAAACTTACAAAGcTCCaTCTTTT aTGAAGATaCCAAGAAATTCCAGTACCTAGATAAAACTTTGTAATCCGCTTTCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTAATAAAATGAGGATGTTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Cinchona TGATAACTTTCAAATTCAGAGAAACCCTGGAATcTAATAAAAAcAGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCGAAAAcTTCCGAAAcGACT GcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACGAAACGACTGA ATCTGTAcTTTATATATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAGTCGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCTGcATAGATCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGCCTGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCCTATTTGACcTCCCCa aAACTATa a TTAcTCCTATCCTTCTTTTCATTAGCGGTTCCAAATTCCTTAGCCATTCACTC TAa a a TTaCTCTTa a a AGAAcATCGATCTGGGCGGAAATGCCaTTTa TTCTT ATCACAaAGGCTaTGT TatatATGATaATa Aa cCATACAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGA TcAa CATACTGAAACTTACAAAGcTCCaTCTTTT aTTAAGATaCCAAGAAATTCCAGTACCTAGATAAAACTTTGTAATCCGCTTTCCTTaaCTTTa aTAATTGACATAGAcCTCATTTTCTAAGAAAATGAGGATGTTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Hoffmannia TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCa AAAa GAcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCGAAAAcTTCAGAAAcGAAT GcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa CATGACGACCCGACTGA ATCTGTAaTTTATATATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAATAATCGAAaTATTCAcTTGATCAAACGATTCCCcTCCATAGTCTGcATAGATCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGCCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGACTATTTGACcTCCCCa aAACTATa a TTAcTCCTATCCTTCTTTTCGTTAGCGGTTCAAAATTCCTTATCCATTCACTC TAa a a TTaCTCTTa a a AGAAcATCGATCTGGGCGGAAATGCCaCTTa TTCTT ATCACAaAGTCTaTGT TatatATGATaATa Aa cCATACAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAAATACTCATACTGAAACTTACAAAAcTCCaTCTTTT aTTAAGATaCCAAGAAATTCCAGTACCTAGATAAAACTTTGTAATCCGCTTTCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTAATAAAATGAGGATGTTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Hamelia TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAGcGGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCa AACa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCGAAAAcTTCAGAAAcGAAT GcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa CATGACGACCCGACTGA ATCCGTAaTTTATAGATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTCGATCAAACGATTCACcTCCATGGTCTGcATAGATCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGCCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGACTATTTTACcTCCCCa aAACTATa a TTAcTCCTATCCTTCTTTTCGTTAGCGGTTCAAAATTCCTTATCCATTCACTC TAa a a TTaCTCTTa a a AGAAcATCGATCTGGGCGGAAATGCCaCTTa TTCTT ATCACAaAGTCTaTGT TatatATGATaATa Aa cCATACAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAAATACTCATACTGAAACTTACAAAAcTCCaTCTTTT aTTCAGATaCCAAGAAATTCCAGTACCTAGATAAAACTTTGTAATCCGCTTTCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTAATAAAATGAGGATGTTACATTGaGAGCGGGTCGGGATAGCTCAGCTGG Cosmibuena TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa ACGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCGAAAAcTTCAGCAAcGAAT GcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa CATGACGACCCGACTGA ATCTGTAaTTTATATATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCTGcATAGATCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGCCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGACTATTTGACcTCCCCa aAACTATa a TCAcTCCTACCCTTCTTTTCGTTAGCGGTTCAAAATTCCTTATCCATTCACTC TAa a a TTaCTCTTa a a AGAAcATCGATCTGGGCGTAAATGCCaCTTa TTCTT ATCACAaAGTCTaTGT TatatATGATaATa Aa cCATACAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAAATACTCATACTGAAACTTACAAAGcTCCaTCTTTT aTTAAGATaCCAAGAAATTCCAGTACCTAGATAAAACTTTGTAATCCGCTTTCTTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTAATAAAATGAGGATGTTCCATTGaGGACTGGTCGGGATAGCTCAGCTGG Chione TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCAGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGACTGCGTTAGTAGAGAAATCTTTCCATCGAAAAcTTCAGAAAcGAAT GcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACGACCCGACTGA ATCTGTAaTTTATATATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCGTAGTCTGcATAGATCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGCCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTT AAATCGTGAGGGTTaCaagtccctctatccccAAAAAGACTATTTGACcTCCCCa aAACTATa a TTAcTCCTATCCTTCTTTTCGTTAGTGGTTCCAAATTCCTTATCCATTCACTC TAa a a TTaCTCTTa a a AGAAcATCGATCTGGGCGGAAATGCCaCTTa TTCTT ATCACAaAGTCTaTGT TatatAAGATaATa AcAcCATACAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCAGTTGAATGATTTCCAATCGAaTcAcaTAAATACTCATACTGAAACTTACAAAGcTCCaTCTTTT aTTAAGATaCCAAGAAATTCCAGTACCTAGATAAAACTTTGTAATCCGCTTTCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTAATAAAATGAGGATGTTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Isertiah TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCa AAAa GAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCTATCGAAAAcTTCAGAAAcGAAT GcAAGcTGcAAGGATAAA GGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACGACCCGACTGA ATCTGTAaTTTATATATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCAAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCTGcATAGATCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATGCCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAA GCCTATTTGACcTCCCCa aAACTATa a TTAcTCCTATCCTTCTTTTCGTTAGGGGTTCAAAATTCCTTATCCATTCACTC TAa a a TTaCTCTTa a a CGAAcATCGATCTGGGAGGAAATGCCaCTTa TTCTT ATCACAaAGTCTaTGT TatatATGATaATa Aa cCATACAa AATcGAAcCaATCCTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAAATACTCATACTGAAACTTACAAAGcTCCaTCTTTT aTTAAGATaCCAAGAAATTCCAGTACCTAGATAAAACTTTGTAATTAGCTTTCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTAATAAAATGAGGATGTTACATTAaGGACTGGTCGGGATAGCTCAGCTGG Isertiac TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCGAAAAcTTCAGAAAcGAAT GcAAGcTGcAAGGATAAA GGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACGACCCGACTGA ATCTGTAaTTTATATATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCAAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCTGcATAGATCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATGCCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAGAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCCTATTTGACcTCCCCa aAACTATa a TTAcTCCTATCCTTCTTTTCGTTAGGGGTTCAAAATTCCTTATCCATTCACTC TAa a a TTaCTCTTa a a CGAAcATCGATCTGGGAGGAAATGCCaCTTa TTCTT ATCACAaAGTCTaTGT TatatATGATaATa Aa cCATACAa AATcGAAcCaATCCTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAAATACTCATACTGAAACTTACAAAGcTACaTCTTTT aTTAAGATaCCAAGAAATTCCAGTACCTAGATAAAACTTTGTAATTAGCTTTCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTAATAAAATGAGGATGTTACATTAaGGACTGGTCGGGATAGCTCAGCTGG Uncaria TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAa GGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTAGATGCATTAGTAGAGAGATCCTTCCATCGAAAAcTTCAGAAAcGAAT GcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACGACCCGACTGA ATCTGTAaTTTATATATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCTGcATAGATCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATGCCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCGTATTTGCCcTCCCCa aAACTATa a TTAcTCCTATCCTTCTTTTCGTTAGCGGTTCAAAATTCCTTATCCATT CTCTTa a a AGAAcATCGATCTGGGCGGAAATCCCaCTTa TTCTT ATCACAaAGTCTaTGT TatatATGATaATa Aa cTATACAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCAAaTcAcaTAAATATTCATACTGAAACTTACAAAGcTCCaTCTTTT aTTAAGATaCCAAGAAATTCCAGTACCTAGATAAAATTTTGTAATCCGCTTTCCTTaaCTTTa aTAATTGACATAGAcCCCAATTTCTAATAAAATTAAGATGTTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Sarcocephalus TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAa GGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTAGATGCATTAGTAGAGAGATCTTTCCATCAAAAAcTTCAGAAAcGAAT GcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACGACCCGACTGAAATCTATAaTTTATATATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACGTTGAAGAAAGAATCGAAaTATTCAcTTGATCAAACGATTCACcTCCATAGTCTGcATAGATCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATGCCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCCTATTTGACcTCCCCa aAACTATa a TTAcTCCTATCCTTCTTTTCGTTAGCGGTTCAAAATTCCTTATCCATTCATTC TAa a a TTaCTCTTa a a AGAAcATCGATCTGGGCGGAAATCCCaCTTa TTCTT ATCACAaAGTCTaTGT TatatATGATaATa Aa cCATACAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCAAaTcAcaTAAATATTCATACTGAAACTTACAAAGcTCCaTCTTTT aTTAAGATaCCAAGAAATTCCAGTACCTAGATAAAATTTTGTAATCCGCTTTCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTAATAAAATTAAGATGTTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Cephalanthus TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcAGGGCAATCCTGAGCCAAATCCTGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTAGATGCATTAGTAGAGAGACCTTTCCATCGAAAAcTTCAGAAAcGAAT GcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACGACCCGACTGA ATCTGTAaTTTATATATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTAAAGAAAGAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCTGcATAGATCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCCATTCTACATGTCAATGCCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCCTATTTGACcTCCCCa aAACTATa a TTAcTCCTATCCTTCTTTTCGTTAGCGGTTCAAAATTCCTTATCCATTCACTC TAa a a TTaCTCTTa a a AGAAcATCGATCTGGGCGGAAATCCCaCTTa TTCTT ATCACAaAGTCTaTGT TatatATGATaATa Aa cCATACAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCAAaTcAcaTAAATACTCATACTGAAACTTACAAAGcTCCaTCTTTT aTTAAGATaCCAAGAAATTCCAGTACCTAGATAAAATTTTGTAATCCGCTTTCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTAATAAAATTAGGATGTTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Coutaportlagh TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa TCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTACATCCAAAAcTTCAGAAAcGAAT GcAAGcTGcAAGGAGAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACGACTCGACTGA ATCTGTAaTTTATATATaGAAAACGGAAGAATTAGTGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCTGcATAGTTCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCTGTTCTACATGTCAATGCCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAA AATCGTG TaCaagtccctctatccccAAAAAGCCTATTTGACcTTCCCa aAACGATa a TTAcTCCTATCCTTCTTTTCGTTAGCGGTTCAAAATTCCTTATCCATTTGCTC TAa a a TTaCTCTTa a a CGAAcATCGATCTGGGCGGAAATGCCaCTTa TTCTT ATCATAaAATCTaTGT TatGtATGATaATa Aa cCATACAcATACAAATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaGAAATACTCATATTGAAACTTACAAAGcTCCaTCTTTT aTTAAGATaCCAAGAAATTTCAGTACCTAGATAAAACTTTGTAATTCGCTTTCCTTaaCTTTa aTAATTGACATAGAcCTCATTTTCTAATAAAATGAGGATGTTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Coutaportlagu TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa TCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCCAAAAcTTCAGAAAcAAAT GcAAGcTGcAAGGAGAAA GGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACGACTCGACTGA ATCTGTAaTTTATATATaGAAAACGGAAGAATTAGTGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAAACGATTCACcTCCATAGTCTGcATAGTTCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCTGTTCTACATGTCAATGCCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCCTATTTGACcTCCCCa aAACGATa a TTAcTCCTATCCTTCTTTTCATTAGCGGTTCAAAATTCCTTATCCATTTGCTC TAa a a TTaCTCTTa a a AGAAcATCGATCTGGGCGGAAATGCCaCTTa TTCTT ATCATAaAATCTaTGT TatatATGATaATa Aa cCATACAcATACAAATcGAAcCaATCTTTcGAGcTAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAAATACTCATACTGAAACTTACAAAGcTCCaTCTTTT aTTAAGATaCCAAGAAATTTCAGTACCTAGATAAAACTTTGTAATTCGCTTTCCTTaaCTTTa aTAATTGACATAGAcCTCATTTTCTAATAAAATGAGGATGTTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Hintonia TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa TCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCCAAAAcTTCAGAAAcGAAT GcAAGcTGcAAGGAGAAA CGTAcTTGAATACTAcTa aaATCAAAaCGATTa AATGACGACTCGACGGA ATCTGTAaTTTATATATaGAAAACGGAAGAATTAGTGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCTGcATAGTTCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCTGTTCTACATGTCAATGCCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCCTATTTGACcTCCCCa aAACGATa a TTAcTCCTATCCTTCTTTTCGTTAGCGGTTCAAAATTCCTTATCCATTTGCTC TAa a a TTaCTCTTa a a AGAAcATCGATCTGGGCGGAAATGCCaCTTa TTCTT ATCATAaAATCTaTGT TatatATGATaATa Aa cCATACAcATACAAATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAAATACTCATACTGAAACTTACAAAGcTCCaTCTTTT aTTAAGATaCCAAGAAATTTCAGTACCTAGAAAAAATTTTGTAATTCGCTTTCCTTaaTTTTa aTAATTGACATAGAcCTCATTTTCTAATAGAATGAGGATGTTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Exostemap TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa TCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCCAAAAcTTAAGAAAcGAAT GcAAGcTGcAAGGAGAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACGACTCGACGGA ATCTGTAaTTTATATATaGAAAACGGAAGAATTAGTGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCTGcATAGTTCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCTGTTCTACATGTCAATGCCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCCTATTTGACcTCCCCa aAACGATa a TTAcTCCTATCCTTCTTTTCGTTAGCGGTTCAAAATTCCTTATCCATTTGCTC TAa a a TTaCTCTTa a a AGAAcATCGATCTGGGCGGAAATGCCaCTTa TTCTT ATCATAaAATCTaTGT TatatATGATaATa Aa cCATACAcATACAAATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAAATACTCATACTGAAACTTACAAAGcTCCaTCTTTT aTTAAGATaCCAAGAAATTTCAGTACCTAGATAAAACTTTGTAATTCGCTTTCCTTaaCTTTa aTAATTGACATAGAcCTCATTTTCTAATAAAATGAGGATGTTACGTTGaGGACTGGTCGGGATAGCTCAGCTGG Erithalis TGATAACTTTCAAATTCAGAGAAACCCCGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa TCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCCAAAAcTTCAGAAAcGAAT GcAAGcTGcAAGGAGAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACGACTCGACGGA ATCTGTAaTTTATATATaGAAAACGGAAGAATTAGTGTGAATAGATTCCACATTGAAGAAAAAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCTGcATAGTTCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCTGTTCTACATGTCAATGCCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTTAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCGTATTTGACcTCCCCa aAACGATa a TTAcTCCTATCCTTCTTTTCGTTAGCGGTTCAAAATTCCTTATCCATTTGCTC TAa a a TTaCTCTTa a a AGAAcATCGATCTGGGCGGAAATGCCaCTTa TTCTT ATCATAaAATCTaTGT TatatATGATaATa Aa cCATACAcATACAAATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAAATACTCATACTGAAACTTACAAAGcTCCaTCTTTT aTTAAGATaCCACGAAATTTCAGTACCTAGATAAAACTTTGTAATTCGCTTTCCTTaaCTTTa aTAATTGACATAGAcCTCATTT AAAATGAGGATGTTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Exostemal TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAGcGGGGCAATCCTGAGCCAAATCCTGTTTTa TCGAAACCa AAAa GGcTTCGGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCCAAAAcTTCAGAAAcGAAT GcAAGcTGcAAGGAGAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACGACTCGACGGA ATCTGTAaTTTATATATaGAAAACGGAAGAATTAGTGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCTGcATAGTTCTTTTCAAGAGCTGATTa AATCGGACGAGAATAAAGATAGAGTCCTGTTCTACATGTCAATGCCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCCTATTTGACcTCCCCa aAACGATa a TTAcTCCTATCCTTCTTTTCGTTAGCGGTTCAAAATTCCTTATCCATTTGCTC TAa a a TTaCTCTTa a a AGAAcATCGATCTGGGCGGAAATGCCaCTTa TTCTT ATCATAaAATCTaTGT TatatATGATaATa Aa cCATACAcATACAAATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAAATACTCATACTGAAACTTACAAAGcTCCaTCTTTT aTTAAGATaCCAAGAAATTTCAGTACCTAGATAAAACTTTGTAATTCGCTTTCCTTaaCTTTa aTAATTGACATAGAcCTCATTTTCTAATAAAATGAGGATGTTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Coutareah TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa TCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCCAAAAcTTCAGAAAcGAAT GcAAGcTGcAAGGAGAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACGACTCGACAGA ATCTGTAaTTTATATATaGAAAACGGAAGAATTAGTATGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCTGcATAGTTCTTTTCAAGAGCTGATTa AATCGGACGAGAATAAAGATAGAGTCCTGTTCTACATGTCAATGCCGGCAACAATGAAATTTATAGTa AAGAAGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCCTATTTGACcTCCCCa aAACGATa a TTAcTCCTATCCTTCTTTTCATTAGCGGTTCAAAATTCCTTATCCATTTGCTC TAa a a TTaTTCTTa a a AGAAcATCGATCTGGGCAGAAATGCCaCTTa TTCTT ATCATAaAATCTaTGT TatatATGATaATa Aa cCATACAcATACAAATcGAAcCaATCTTTcGAGcCAAcTAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAAATACTCATACTGAAACTTACAAAGcTCCaTCTTTT aTTAAGATaCCAAGAAATTTCAGTACCTAGATAAAACTTTGTAATTCGCTTTCCTTaaCTTTa aTAATTGACATAGAcCTCATTTTCTAATAAAATGAGGATGTTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Coutareaa TGATAACTTTCAAATTCAGAGAAACCCCGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa TCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCCAAAAcTTCAGAAAcGAAT GcAAGcTGcAAGGAGAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACGACTCGACGGA ATCTGTAaTTTATATATaGAAAACGGAAGAATTAGTATGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCTGcATAGTTCTTTTCAAGAGCTGATTa AATCGGACGAGAATAAAGATAGAGTCCTGTTCTACATGTCAATGCCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATC GTTaCaagtccctctatccccAAAAAGCCTATTTGACcTCCCCa aAACGATa a TTAcTCCTATCCTTCTTTTCATTAGCGGTTCCAAATTCCTTATCCATTTGCTC TAa a a TTaCTCTTa a a AGAAcATCGATCTGGGCGGAAATGCCaCTTa TTCTT ATCATAaAATCTaTGT TatatATGATaATa Aa cCATTCAcATACAAATcGAAcCaATCTTTcGAGcCAAcTAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAAATACTCATACTGAAACTTACAAAGcTCCaTCTTTT aTTAAGATaCCAAGAAATTTCAGTACCTAGATAAAACTTTGTAATTCGCTTTCCTTaaCTTTa aTAATTGACATAGAcCTCATTTTCTAATAAAATGAGGATGTTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Cubanola TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa TCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCCAAAAcTTCAGAAAcGAAT GcAAGcTGcAAGGAGAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACGACTCGACGGA ATCTGTAaTTTATATATaGAAAACGGAAGAATTAATGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCCGcATAGTTCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCTGTTCTACATGTCAATGCCGACAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCGTATTTGACcTCCCCa aAACGATa a TTAcTCCTATCCTTCTTTTCGTTAGCGGTTCAAAATTCCTTATCCATTTGCTC TAa a a TTaCTCTTa a a AGAAcATCGATCTGGGCGGAAATGCCaCTTa TTCTT ATCATAaAATCTaTGT TatatATGATaATa Aa cCATACAcATACAAATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAAATACTCATACTGAAACTTACAAAGcTCCaTCTTTT aTTAAGATaCCAAGAAATTTCAGTACCTAGATAAAACTTTGTAATTCGCTTTCCTTaaCTTTa aTAATTGACATAGATCTCATTTTCTAATAAAATGAGGATGTTACATTGaGGACTGGTCGGGATAGCTCAGCTGG PortlandA TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa TCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCCAAAAcTTCAGAAAcGAAT GcAAGcTGcAAGGAGAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGAAGACTCGACGGA ATCCGTAaTTTATATATaGAAAACGGAAGAATTAATGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCCGcATAGTTCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCTGTTCTACATGTCAATGCCGACAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccc atcccc AAAAGCGTATTTGACcTCCCCa aAACGATa a TTAcTCCTATCCTTCTTTTCGTTAGCGGTTCAAAATTCCTTATCCATTTGCTC TAa a a TTaCTCTTa a a AGAAcATCGATCTGGGCGGAAATGCCaCTTa TTCTT ATCATAaAATCTaTGT TatatATGATaATa Aa cCATACAcATACAAATcGAAcCaATTTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAAATACTCATACTGAAACTTACAAAGcTCCaTCTTTT aTTAAGATaCCAAGAAATTTCAGTACCTAGATAAAACTTTGTAATTTGCTTTCCTTaaCTTTa aTAATTGACATGGATCTCATTTTCTAATAAAATGAGGATGTTACATTGaGGACTGGTCGGGATAGCTCAGCTGG IsidoreaPun TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa TCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCCAAAAcTTCAGAAAcGAAT GcAAGcTGcAAGGAGAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGAAGACTCGACGGA ATCTGTAaTTTATATATaGAAAACGAAAGAATTAATGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCCGcATAGTTCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCTGTTCTACATGTCAATGCCGACAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTT aAaagtccctctatccccAAAAAGCCTATTTGACcTCCCCa aAACGATa a TTAcTCCTATCCTTCTTTTCGTTAGCGGTTCAAAATTCCTTATCCATTTGCTC TAa a a TTaCTCTTa a a AGAAcATCGATCTGGGCGGAAATGCCaCTTa TTCTT ATCATAaAATCTaTGT TatatATGATaATa Aa cCATACAcATACAAATcGAAcCaATTTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAAATACTCATACTGAAACTTACAAAGcTCCaTCTTTT aTTAAGATaCCAAGAAATTTCAGTACCTAGATAAAACTTTGTAATTTGCTTTCCTTaaCTTTa aTAATTGACATGGATCTCATTTTCTAATAAAATGAGGATGTTACATTGaGGACTGGTCGGGATAGCTCAGCTGG IsidoreaPed TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa TCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCCAAAAcTTCAGAAAcGAAT GcAAGcTGcAAGGAGAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGAAGACTCGACGGA ATCTGTAaTTTATATATaGAAAACGAAAGAATTAATGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCCGcATAGTTCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCTGTTCTACATGTCAATGCCGACAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaAaagtccctctatccccAAAAAGCCTATTTGACcTCCCCa aAACGATa a TTAcTCCTATCCTTCTTTTCGTTAGCGGTTCAAAATTCCTTATCCATTTGCTC TAa a a TTaCTCTTa a a AGAAcATCGATCTGGGCGGAAATGCCaCTTa TTCTT ATCATAaAATCTaTGT TatatATGATaATa Aa cCATACAcATACAAATcGAAcCaATTTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAAATACTCATACTGAAACTTACAAAGcTCCaTCTTTT aTTAAGATaCCAAGAAATTTCAGTACCTAGATAAAACTTTGTAATTTGCTTTCCTTaaCTTTa aTAATTGACATGGATCTCATTTTCTAATAAAATGAGGATGTTACATTGaGGACTGGTCGGGATAGCTCAGCTGG CatesbaeaP TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa TCGAAACCa AAAa GGcTTCCGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCCAAAAcTTCAGAAAcGAAT GcAAGcTGcAAGGAGAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGAAGACTCGACGGA ATCTGTAaTTTATATATaGAAAACGGAAGAATTAATGTGAATAGATTCCACATTGAAGAAAGAATTGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCCGcATAGTTCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCTGTTCTACATGTCAATGCCGACAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCGTATTTGACcTCCCCa aAACGATa a TTAcTCCTATCCTTCTTTTCGTTAGCGGTTCAAAATTCCTTATCCATTTGCTC TAa a a TTaCTCTTa a a AGAAcATCGATCTGGGCGTAAATGCCaCTTa TTCTT ATCATAaAATCTaTGT TatatATGATaATa Aa cCATACAcATACAAATcGAAcCaATTTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAAATACTCATACTGAAACTTACAAAGcTCCaTCTTTT aT AAGATaCCAAGAAATTTCAGTACCTAGATAAAACTTTGTAATTTGCTTTCCTTaaCTCTa aTAATTGACATAGATCTCATTTTCTAATAAAATGAGGATGTTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Phyllacanthus TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa TCGAAACCa AAAa GGcTTCCGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCCAAAAcTTCAGAAAcGAAT GcAAGcTGcAAGGAGAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGAAGACTCGACGTA ATCTGTAaT TATATATaGAAAACGGAAGAATTAATGTGAATAGATTCCACATTGAAAAAAGAATTGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCCGcATAGTTCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCTGTTCTACA a aagtccctctatccccAAAAAGCCTATTTGACcTCCCCa aAACGATa a TTAcTCCTATCCTTCTTTTCGTTAGCGGTTCAAAATTCCTTATCCATTTGCTC TAa a a TTaCTCTTa a a AGAAcATCGATCTGGGCGTAAATGCCaCTTa TTCTT ATCATAaAATCTaTGT TatatATGATaATa Aa cCATACAcATACAAATcGAAcCaATTTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAAATACTCATACTGAAACTTACAAAGcTCCaTCTTTT aTTAAGATaCCAAGAAATTTCAGTACCTAGCTAAAACTTTGTAATTTGCTTTCCTTaaCTCTa aTAATTGACATAGATCTCATTTTCTAATAAAATGAGGATGTTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Catesbaeaspi AAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCCAAAAcTTCAGAAAcGAAT GcAAGcTGcAAGGAGAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGAAGACTCGACGGA ATCTGTAaTTTATATATaGAAAACGGAAGAATTAATGTGAATAGATTCCACATTGAAGAAAGAATTGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCCGcATAGTTCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCTGTTCTACATGTCAATGCCGACAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccTtctatccccAAAAAGCCTATTTGACcTCCCCa aAACGATa a TTAcTCCTATCCTTCTTTTCGTTAGCGGTTCAAAATTCCTTATCCATTTGCTC TAa a a TTaCTCTTa a a AGAAcATCGATCTGGGCGTAAATGCCaCTTa TTCTT ATCATAaAATCTaTGT TatatATGATaATa Aa cCATACAcATACAAATcGAAcCaATTTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAAATACTCATACTGAAACTTACAAAGcTCCaTCTTTT aTTAAGATaCCAAGAAATTTCAGTACCTAGCTAAAACTTTGTAATTTGCTTTCCTTaaCTCTa aTAATTGACATAGATCTCATTTTCTAATAAAATGAGGATGTTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Schmidtottia TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa TCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCCAAAAcTTCAGAAAcGAGT GcAAGcTGcAAGGAGAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACGACTCGACGGA ATCTGTAaTTTATATATaAAAAACAGAAGAATTAATGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCTGcATAGTTCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCTGTTCTACATGTCAATGCCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCCTATTTGACcTCCCCa aAACGATa a TTAcTCCTATCCTTCTTTTCGTTAGCGGTTCAAAATTCTTTATCCATTTGCTC TAa a a TTaCTCTTcCTCTTa a AGAAcATCGATCTGGGCGGAAATGCCaTTTa TTCTT ATCATAaAATCTaTGT TatatATGATaATa Aa cCATACAcATACAAATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAAATACTCATACTGAAACTTACAAAGcTCCaTCTTTT aTTAAGATaCCGAGAAATATCAGTACCTAGATAAAACTTTGTAATTCGCTTTCCTTaaCTTTa aTAATTGACATAGAcCTCGTTTTCTAATAAAATGAGGATGTTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Phialanthus TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa TCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCCAAAAcTTCAGAAAcGAGT GcAATcTGcAAGGAGAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACAACTCGACGGA ATCTGTAaTTTATATATaAAAAACGGAAGAATTAATGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCTGcATAGTTCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCTGTTCTACATGTCAATGCCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCCTATTTGACcTCCCCa aAACGATa a TTAcTCCTATCCTTCTTTTTGTTAGCGGTTCAAAATTCTTTATCCATTTGCTC TAa a a TTaCTCTTcCTCTTa a AGAAcATCGATCTGGGCGGAAATGCCaCTTa TTCTT ATCATAaAATCTaTGT TatatATGATaATa Aa cCATACAcATACAAATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAAATACTCATACCGAAACTTACAAAGcTCCaTCTTTT aTTAGGATaCCGAGAAATTTCAGTACCTAGATAAAACTTTGTAATTCGCTTTCCTTaaCTTTa aTAATTGACATAGAcCTCGTTTTCTAATAAAATGAGGATGTTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Ceratopyxis TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa TCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCATTAGTAGAGAAATCTTTCCATCCAAAAcTTCAGAAAcGAGT GcAAGcTGcAAGGAGAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACAACTCGACGGA ATCTGTAaTTTATATATaAAAAACGGAAGAATTAATGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCTGcATAGTTCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCTGTTCTACATGTCAATGCCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCCTATTTGACcTCCCCa aAACGATa a TTAcTCCTATCCTTCTTTTCGTTAGCGGTTCAAAATTCTTTATCCATTTGCTC TAa a a TTaCTCTTcCTCTTa a AGAAcATCGATCTGGGCGGAAATGCCaCTTa TTCTT ATCATAaAATCTaTGT TatatATGATaATa Ca cCATAAAcATACAAATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAAATACTCATACTGAAACTTACAAAGcTCCaTCTTTT aTTAAGATaCCGAGAAATTTCAGTACCTAGATAAAACTTTGTAATTCGCTTTCCTTaaCTTTa aTAATTGACATAGAcCTCGTTTTCTAATAAAATGAGGATGTTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Badusa AAAAAGCCTATTTGACcTCCCCa aAACGATa a TTAcTCCTATCCTTCTTTTCGTTAGCGGTTCAAAATTCCTTATCCATTTGCTC TAa a a TTaCTCTTcCTCTTa a AGAAcATGGATCTGGGCGGAAATGCCaCCTa TTCTT ATCATAaAATCTaTGT TatatATGATaATa Aa cCATACAcATACAAATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAAATACTCATACTGAAACTTATAAAGcTCCaTCTTTT aTTAAGATaCCGAGAAATTTCAGTACCTAGATAAAACTTTGTAATTCGCTTTCCTTaaCTTTa aTAATTGACATAGAcCTCGTTTTCTAATAAAATGAGGATGTTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Siemensia TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa TCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCCAAAAcTTCAGAAAcGAAT GcAGGcTGcAAGGAGAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACGACTCGACGGA ATCTGCAaTTTATATATaAAAAACGGAAGAATTAATGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCTGcATAGTTCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCTGTTCTACATGTCAATGCCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCCTATTTGACcTCCCCa aAACGATa a TTAcTCCTATCCTTCTTTTCGTTAGTGGTTCAAAATTCCTTATCCATTTGCTC TAa a a TTaCTCTTcCTCTTa a AGAAcATCGATCTGGGCGGAAATGCCaCCTa TTCTT ATCATAaAATCTaTGT TatatATGATaATa Aa cCATACAcATACAAATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAAATACTCATACTGAAACTTACAAAGcTCCaTCTTTT aTTAAGATaCCGAGAAATTTCAGTACCTAGATAAAACTTTGTAATTCGCTTTCCTTaaCTTTa aTAATTGACATAGAcCTCGTTTTCTAATAAAATGAGGATGTTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Scolosanthus TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa TCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCCAAAAcTTCAGAAAcGAAT GcAGGcTGcAAGGAGAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACGACTCGACAGA ATCTGTAaTATATATATaAAAAACGGAAGAATTAATGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCTGcATAGTTCTTGAAAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCTGTTCTACATGTCAATGCCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCCTATTTGACcTCTCCa aAACGATa a TTAcTCCTATCCTTCTTTTCGTTAGCCGTTCAAAATTCCTTATCCATTTGCTC TAa a a TTaCTCTTcCTCTTa a AGAAcATCGATCTGGGCGGAAATGCCaCCTa TTCTT ATCATAaAATCTaTGT TatGtATGATaATa Aa cCATACAcATACAAATcGAAcCaATCTTTcGAGcTAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAAATACTCATACTGAAACTTACAAAGcTCCaTCTTTT aTTAAGATaCCGAGAAATTTCAGTACCTAGATAAAACTTTGTAATTCGCTTTCCTTaaCTTTa aTAATTGACATAGAcCTCGTTTTCTAATAAAATGAGGATGTTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Chiococcaa TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa TCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGCTGGCTGCGTTAGTAGAGAAATCTTTCCATCCAAAAcTTCAGAAAcGAAT GcAGGcTGcAAGGAGAAA CGTAcTTGAATACTAcTa acATCAAAaTGATTa AATGACGACTCGACAGA ATCTGTAaTATATATATaAAAAACGGAAGAATTAATGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCTGcATAGTTCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCTGTTCTACATGTCAATGCCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCCTATTTGACcTCTCCa aAACGATa a TTAcTCCTATCCTTCTTTTCGTTAGCGGTTCAAAATTCCTTATCCATTTGCTC TAa a a TTaCTCTTcCTCTTa a AGAAcATCGATCTGGGCGGAAATGCCaCCTa TTCTT ATCATAaAATCTaTGT TatatATGATaATa Aa cCATACAcATACAAATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAAATACTCATACTGAAACTTACAAAGcTCCaTCTTTT aTTAAGATaCCGAGAAATTTCAGTACCTAGATAAAACTTTGTAATTCGCTTTCCTTaaCTTTa aTAATTGACATAGAcCTCGTTTTCTAATAAAATGAGGATGTTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Asemnantha TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCTGTTTTa TCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGCTGGCTGCGTTAGTAGAGAAATCTTTCCATCCAAAAcTTCAGAAAcGAAT GcAGGcTGcAAGGAGAAA CGTAcTTGAATACTAcTa acATCAAAaTGATTa AATGACGACTCGACAGA ATCTGTAaTATATATATaAAAAACGGAAGAATTAATGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCTGcATAGTTCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCTGTTCTACATGTCAATGCCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAGAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCCTATTTGACcTCTCCa aAACGATa a TTAcTCCTATCCTTCTTTTCGTTAGCGGTTCAAAATTCCTTATCCATTTGCTC TAa a a TTaCTCTTcCTCTTa a AGAAcATCGATCTGGGCGGAAATGCCaCCTa TTCTT ATCATAaAATCTaTGT TatatATGATaATa Aa cCATACAcATACAAATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAAATACTCATACTGAAACTTACAAAGcTCCaTCTTTT aTTAAGATaCCGAGAAATTTCAGTACCTAGATAAAACTTTGTAATTCGCTTTCCTTaaCTTTa aTAATTGACATAGAcCTCGTTTTCTAATAAAATGAGGATGTTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Strumpfia TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAcGGGGCAATCCTGAGCCAAATCCCGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGCTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCCAAAAcTTCAGAAAcGAAT GcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACGACCCGACTGA ATCTGTAaTTTATATATaGAAAACAGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCGcTTGATCAAACGATTCACcTCCATAGTCTGcATAGATCTTTTCAAGAACTGATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGCCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAA AATCGTGAGGGTTaCaagtccctctatccccAAAAAGCCTATTTGACcTCCCCa aAACTGTa a TTAcTCCTATCCTTCTTTTCGTTAGCGGTTCAAAATTCCTTATCCATTCACTC TAa a a TTaCTCTTa a a AGAA GGAAATGCCaTTTa TTCTC ATCACAaAGTCTaTGT TatatATGATaATa Aa cCATACAa AATcGAAcGaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTGCAATCGAaTcAcaTAAATACTCATACTGAAACTTACAAAGcTCCaTCTTTT aTTAAGATaCCAAGAAATTTCAGTACCTAGATAAAACTTTGTAATCCGCTTT TTTaaCTTTa aTAATTGACATAGAcCTCATTTTCTAATAAAATGAGGATGTTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Rogieraamo TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAa GGGCAATCCTGAGCCAAATCCCGTTTTa CCGAAACCa AAAcTCTAGGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGTTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCGAAAAcTTCAAAAAcGAAT GcAAGcTGcAAGGATAAA CGTAcTTAAATACTAcTa aaATCAAAaTGATTa AATGACGACCCGACTGA ATCTGTAaTTTATATATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCTGcATAGATCTTTTCAAGAACTTATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGCCGGCAACAATGAAATTTATAGTa AAAAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCCTATTTGACcTCCCCa aAACTATa a TTAcTCCTATCCTTCTTTTCGTTAGCGGTTCCAAATTCCTTATCCATTCACTC TAa a a TTaCTCTTa a a AGAAcATCGATCTGGGCGGAAATGCAcCTTa TTCTT ATCACAaAGTCTaTGT TatatATGATaATa Aa cCATACAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAAATATTCATACTGAAACTTACAAAGcTCCaTCTTTT aTTAAGATaCCAAGAAATTCCAGTACCTAGATAAAACTTTGTAATTCGCTTTCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTAATAAAATGAGGATGTTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Rogieracor TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAa GGGCAATCCTGAGCCAAATCCCGTTTTa CCGAAACCa AAAcTCTAGGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGTTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCGAAAAcTTCAAAAAcGAAT GcAAGcTGcAAGGATAAA CGTAcTTAAATACTAcTa aaATCAAAaTGATTa AATGACGACCCGACTGA ATCTGTAaTTTATATATaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCTGcATAGATCTTTTCAAGAACTTATTa AATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGCCGGCAACAATGAAATTTATAGTa AAAAGGAAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCCTATTTGACcTCCCCa aAACTATa a TTAcTCCTATCCTTCTTTTCGTTAGCGGTTCCAAATTCCTTATCCATTCACTC TAa a a TTaCTCTTa a a AGAAcATCGATCTGGGCGGAAATGCAcCTTa TTCTT ATCACAaAGTCTaTGT TatatATGATaATa Aa cCATACAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAAATATTCATACTGAAACTTACAAAGcTCCaTCTTTT aTTAAGATaCCAAGAAATTCCAGTACCTAGATAAAACTTTGTAATTCGCTTTCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTAATAAAATGAGGATGTTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Javorkaea GGGCAATCCTGAGCCAAATCCCGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGTTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCGAAAAcTTCAAAAAcGAAT GcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACGACCCGACTGA ATCTGTAaTTTATATACaGAAAACGGAAGAATTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCTGcATAGATCTTTTCAAGAACTGATTcTAATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGCCGGCAACAATGAAATTTATAGTa AAGAGGCAAATCCGTCGACTTTAAAAATCGTGAGGGTTaCaagtccctctatccccAAAAAGCCCATTTGACcTCCCCa aGACTATa a TTAcTCCTATCCTTCTTTTCGTTAGCGGTTCTAAATTCCTTATCTATTCACTC TAa a a TTaCTCTTa a a AGAAcATCGATCTGGGCGGAAATGCCaCTTa TTCTT ATCACAaAGTCTaTGT TatatATGGTaATa Aa cCATACAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAAATATTCATACTGAAACTTACAAAGcTCCaTCTTTT aTTAAGATaCCAAGAAATTCCAGTACCTAGATAAAACTTTGTAATTCGCTTTCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTAATAAAATGAGAATGTTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Aracnotryxleu ACCCTGGAATaTAATAA GGGCAATCCTGAGCCAAATCCCGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGTTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCGAAAAcTTCAAAAAcGAAT GcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACGACCCGACTGA ATCTGTAaTTTATATACaGAAAACGGAAGAGTTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCTGcATGGATCTTTTCAAGAACTGATTcTAATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGCCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCG TTAAAAATCGTG GGG TaCaagtccctctatccccAAAAAGCCTATTTGACcTCCCCa aGACTATa a TTAcTCCTATCCTTCTTTTCGTTAGCGGTTCAAAATTCCTTATCTATTCATTC TAa a a TTaCTCTTa a a AGAAcATCGATCTGGGCGGAAATGCCaCTTa TTCTT ATCACAaAGTCTaTGT TatatATGGTaATa Aa cCATACAa AATcGAAcCaATCTTTcGAGcCAAcGAAAcTCCCCATTTGAATGATTTACAATCGAaTcAcaTAAATATTCATACTGAAACTTACAAAGcTCCaTCCTTT aTTAAGATaCCAAGAAATTCCAGTACCTAGATAAAACTTTGTAATTCGCTTTCCTTaaCTTTa aTAATTGACATAGAcCCCATTTTCTAATAAAATGAGGATGTTACATTGaGGACTGGTCGGGATAGCTCAGCTGG Aracnotryxleu2287 TGATAACTTTCAAATTCAGAGAAACCCTGGAATaTAATAAAAAa GGGCAATCCTGAGCCAAATCCCGTTTTa CCGAAACCa AAAa GGcTTCAGAAAGTGAAAAGGATAGGTGCAGAGACTCAACGGAAGTTGTTCTAACAAATGGAGTTGGCTGCGTTAGTAGAGAAATCTTTCCATCGAAAAcTTCAAAAAcGAAT GcAAGcTGcAAGGATAAA CGTAcTTGAATACTAcTa aaATCAAAaTGATTa AATGACGACCCGACTGA ATCTGTAaTTTATATACaGAAAACGGAAGAGTTGGTGTGAATAGATTCCACATTGAAGAAAGAATCGAAaTATTCAcTTGATCAAATGATTCACcTCCATAGTCTGcATGGATCTTTTCAAGAACTGATTcTAATCGGACGAGAATAAAGATAGAGTCCCGTTCTACATGTCAATGCCGGCAACAATGAAATTTATAGTa AAGAGGAAAATCCGTCGACTTTAAAAATCG GAGGGTTaCaagtccctctatccccAAAAAGC TATTTGACcTCCCCa aGACTATa a

    Original URL path: http://ajbsupp.botany.org/v89/rova-dna.txt (2016-02-14)
    Open archived version from archive


  • NCHAR 224 FORMAT MISSING GAP INTERLEAVE MATRIX Andryala 0000011000000001010010100000000 0010000001000000000000110000000000010000100 00001000000 000001001 00000110000000000 000000000001001000000111100110010000000000000000 000011000100000 00110 0 00000010000000000010 000000000111 Chlorocrepis 010000000000 01000 101 0 0000010010100010000010010001001100000000000000 000000 010000000001001001000010000000000000 011001000000 00 0000 1001100000 0000100010 0011 000001000000 0 1 0 0 00000 0 0 10000 0 Lactuca 000001100000000100001000000 00010001100011000000000010100000010010010010100100001000000101000100011 00110000000000000100000000000 0 0001111 0000100000 0000 0010000110000000 00000000010 11000001100000000001 0 1000000010 Reichardia 1000000000000100001001000000000000000000000001000000101110001001000001000010000010000010100000010000000100000000000010110100000001000000000 000000100000000100000 010000110010 0010000001 01100000100000000000010 1010100010111 T azorica 2 1100000010010101111110 1010111000111011111100000101011001011010110111100111110000110100011111001111111111110000010111000001111000011010010 11111011001011001100110 1011 01 T barbata 10010001111100000010010101111110010101110001111111111000000010010110110101101111001111100001111000111100011111011111100001101100000011111000010100101001111101100101100110011001011101100011000111100111111111110110101011001000 T coronopifolia 10010001111110000010010111111110010101110001111111111000000010010010110101101111001111101001111000111100011111011111100000101100010011110000010100101111111101100111000110011001111111100011001111100111111111010100101011001000 T crassiuscula 10010001111110000110010111111110010101110001111111111000000010010010110101101111001111101001111000111100011111011111100000101100010011110000010100101011111101100111000110011001111111100001001111100111111111010100101011001000 T farinulosa 1001000111111000001001011111111001010111000111111111100000001001001011010110111100111110100111100010110001111101111110000010110001001111000001010010101111110110011100011001100111111110000100111110011111111 10 001010 10 T glabrescens 1 100100011111100000100101111111100101011100011111111110000000100100101101011011110011111010011110001111000111110111111000001111000100110100000111001010111111011001110001100110011111111000010011111001111111 10 001010 1001000 T glabrescens 2 10010001111110000010010111111110010101110001111111111000000010010010110101101111001111101001111000111100011111111111100000101100010011010000011100101111111101100111000110011001111111100011001111100111111111010100101011001000 T laciniata 1 10110001111110000010010111111110010101110001111111111000000010010010110101101111001111101001111000101100011111011111100000101100010011110000010100101011111101100111000110011001111111100001001111100111111 001 101 0 000 T laciniata 2 10110001111110000010010111111110010101110001111111111000000010010010110101101111001111101001111000101100011111011111100000101100010011110000010100101111111101100111000110011001111111100011001111100111111111010100101011001000 T laciniata 3 100100011111100000100101111111100101011100011 1111111000000010010010110101101111001111101001111000111100011111011111100000101100010011110000010100101111111101100111 0011001100111111110001100111110011 1110101001010110 1000 T laciniata 4 10010001111110000010010111111110010101110001111111111000000010010010110101101111001111101001111000111100011111011111100000101100010011110000010100101011111101100111000110011001111111100001001111100111111 001010 10 100 T laciniata 5 10010001111110000010010111111110010101110001111111111000000010010010110101101111001111101001111000111100011111011111100000101100010011110000010100101011111101100111 0011001100111111110000100111110011111111 0 00101011001000 T laciniata 6 10010001111110000010010111111110110101110001111111111000000010010010110101101111001111101001111000111100011111011111100000101100010011110000010100101011111101100111000110011001111111100001001111100111111111010100101011001000 T laciniata 7 10010001111110000010010111111110110101110001111111111000000010010010110101101111001111101001111000111100011111011111100000101100010011110000010100101011111101100111000110011001111111100001001111100111111111010 00101011001000 T lagopoda 1 100100011111100000100101111 1 1 0 1000 1 1 111100 0 010 1101011011110 11 10 1110001 0111110111111000001011000100111100000101001011111111011001110001100110 11110000100111110011 111010 0010101 1 T lagopoda 2 10010001111110000010010111111110010101110001111111111000000010010010110101101111001111101001111000111100011111011111100000101100010011110000010100101011111101100111000110011001111 1110000100111110011 1 001 10 0 0 T macrorhiza 1001000111110000000001010111111001010111000111011111100000 110010010110101101111001111100001101000111100 1 0110010001111000001010010 1 110011001011 T sp nov A 1 100100011111100000100101111111100101011100011111111110000000100100101101011011110011111010011110001111000111110111111000001011000100110100000101001011111 1101100111000110011001111111100011001111100111111111010100101011001000 T sp nov A 3 10010001111110000010010111011110010101110001111111111000000010010010110101101111001111101001111000111100011111011111100000101100010011010000010100101111111101100111000110011001111111100011001111100111111111010 00101011001000 T sp nov B 11100000100101111111100101011100011111111110000000100100 0110101101111001111101001111000111100011111011111100000101100010011010000010100101011111101

    Original URL path: http://ajbsupp.botany.org/v89/moore.txt (2016-02-14)
    Open archived version from archive


  • genome TTATTAACTCCATCTATAAATCTTTTACATCAAAATTCAAATGATTTTGAGGATTCGTAT 1740 G genome TTATTAACTCCATCTATAAATCTTTTACATCAAAATTCAAATGATTTTGAGGATTCGTAT 1740 Gossyp kirkii TTATTAACTCCATCTATAAATCTTTTACATCAAAATTCAAATGATTTTGAGGATTCGTAT 1740 Kokia drynar TTATTAACTCCATCTATAAATCTTTTACATCAAAATTCAAATGATTTTGAGGATTCGTAT 1740 1750 1760 1770 1780 1790 1800 A genome CAATTTTTTAAAAATGCAACTTTTTCAGTGAGTATAGCTTGTTTCGGAATATTTACAGCA 1794 B genome CAATTTTTAAAAAATGCAACTTTTTCAGTGAGTATAGCTTGTTTCGGAATATTTACAGCA 1794 C genome CAATTTTTCAAAAATGCAACTTTTTCAGTGAGTATAGCTTGTTTCGGAATATTTACAGCA 1800 D genome CAATTTTTTAAAAATGCAACTTTTTCAGTGAGTATAGCTTGTTTCGGAATATTTACAGCA 1800 E genome CAATTTTTTAAAAATGCAACTTTTTCAGTGAGTATAGCTTGTTTCGGAATATTTACAGCA 1794 G genome CAATTTTTTAAAAATGCAACTTTTTCAGTGAGTATAGCTTGTTTCGGAATATTTACAGCA 1800 G genome CAATTTTTTAAAAATGCAACTTTTTCAGTGAGTATAGCTTGTTTCGGAATATTTACAGCA 1800 Gossyp kirkii CAATTTTTTAAAAATGCAACTTTTTCAGTGAGTATAGCTTGTTTCGGAATATTTACAGCA 1800 Kokia drynar CAATTTTTTAAAAATGCAACTTTTTCAGTGAGTATAGCTTGTTTGGGAATATTTACAGCA 1800 1810 1820 1830 1840 1850 1860 A genome TTCCTTTTATATAAACCTTTTTATTCATCTGTACAAAATTTAAACTTACTAAATTCATTT 1854 B genome TTCCTTTTATATAAACCTTTTTATTCATCTTTACAAAATTTAAACTTACTAAATTCATTT 1854 C genome TTCCTTTTATATAAACCTTTTTATTCATCTTTACAAAATTTAAACTTACTAAATTCATTT 1860 D genome TTCCTTTTATATAAACCTTTTTATTCATCTTTACAAAATTTTAACTTTCTAAATTCATTT 1860 E genome TTCCTTTTATATAAACCTTTTTATTCATCTTTACAAAATTTAAACTTACTAAATTCATTT 1854 G genome TTCCTTTTATATAAACCTTTTTATTCATCTGTACAAAATTTAAACTTACTAAATTCATTT 1860 G genome TTCCTTTTATATAAACCTTTTTATTCATCTTTACAAAATTTAAACTTACTAAATTCATTT 1860 Gossyp kirkii TTCCTTTTATATAAACCTTTTTATTCATCTTTACAAAATTTGAACTTACTAAATTCATTT 1860 Kokia drynar TTCCTTTTATATAAACCTTTTTATTCATCTTTACAAAATTTGAACTTACTAAATTCATTT 1860 1870 1880 1890 1900 1910 1920 A genome GTGAAAAGGGGTCCTAAAAGAATTTTATTGGATAAAATGATATATTTGATATATGATTGG 1914 B genome GTGAAAAGGGGTCCTAAAAGAATTTTATTGGATAAAATGATATATTTGATATATGATTGG 1914 C genome GTGAAAAGGGGTCCTAAAAGAATTTTATTGGATAAAATGATATATTTGATATATGATTGG 1920 D genome GTGAAAAGGGGTCCTAAAAGAATTTTATTGGATAAAATGATATATTTTATATATGATTGG 1920 E genome GTGAAAAGGGGTCCTAAAAGGATTTTATTGGATAAAATGATATATTTGATATATGATTGG 1914 G genome GTGAAAAGGGGTCCTAAAAGAATTTTATTGGATAAAATGATATATTTGATATATGATTGG 1920 G genome GTTAAAAGGGGTCCTAAAAGAATTTTATTGGATAAAATGATATATTTGATATATGATTGG 1920 Gossyp kirkii GTGAAAAGGGGTCCTAAAAGAATTTTATTGGATAAAATGATATACTTGATATATGATTGG 1920 Kokia drynar GCGAAAGGGGGTCCTAAAAGAATTTTATTGGATAAAATGATATACTTGATATATGATTGG 1920 1930 1940 1950 1960 1970 1980 A genome TCATATAATCGTGGTTACATAGATATGTTTTATTCAATATCCTTAACAAAAGGTATAAGA 1974 B genome TCATATAATCGTGGTTACATAGATATGTTTTATTCAATATCCTTAACAAAAGGTATAAGA 1974 C genome TCATATAATCGTGGTTACATAGATATGTTTTATTCAATATCCTTAACAAAAGGTATAAGA 1980 D genome TCATATAATCGTGGTTACATAGATCTGTTTTATTCAATATCCTTAACAAAAGGTATAAGA 1980 E genome TCGTATAATCGTGGTTACATAGATATGTTTTATTCAATATCCTTAACAAAAGGTATAAGA 1974 G genome TCATATAATCGTGGTTACATAGATATGTTTTATTCAATATCCTTAACAAAAGGGATAAGA 1980 G genome TCATATAATCGTGGTTACATAGATATGTTTTATTCAATATCCTTAACAAAAGGTATAAGA 1980 Gossyp kirkii TCATATAATCGTGGTTACATAGATACGTTTTATTCAATATCCTTAACAAAAGGTATAAGA 1980 Kokia drynar TCATATAATCGTGGTTACATAGATACGTTTTATTCAATATCCTTAACAAAAGGTATAAGA 1980 1990 2000 2010 2020 2030 2040 A genome GGATTGGCCGAACTAACTCATTTTTTTGATAGGCGAGTAATCGATGGAATTACAAATGGA 2034 B genome GGATTGGCAGAACTAACTCATTTTTTTGATAGGCGAGTAATCGATGGAATTACAAACGGA 2034 C genome GGATTGGCAGAACTAACTCATTTTTTTGATAGGCGAGTAATCGATGGAATTACAAACGGA 2040 D genome GGATTGGCAGAACTAACTCATTTTTTTGATAGGCGAGTAATCGATGGAATTACAAACGGA 2040 E genome GGATTGGCCGAACTAACTCATTTTTTTGATAGGCGAGTAATCGATGGAATTACAAACGCA 2034 G genome GGATTGGCCGAACTAACTCATTTTTTTGATAGGCGAGTAATCGATGGAATTACAAATGGA 2040 G genome GGATTGGCAGAACTAACTCATTTTTTTGATAGGCGAGTAATCGATGGAATTACAAACGGA 2040 Gossyp kirkii GGATTGGCAGAACTAACTCATTTTTTTGATAGGCGAGTAATCGATGGAATTACAAATGGA 2040 Kokia drynar GGATTGGCAGAACTAACTCATTTTTTTGATAGGCGAGTAATCGATGGAATTACAAATGGA 2040 2050 2060 2070 2080 2090 2100 A genome GTAGGCATTACAAGTTTTTTTGTGAAATGGGCGGACCACAGTATAAGCTAATAACTATAG 2094 B genome GTAGGCATTACAAGTTTTTTTGTGAAATGGGCGGACCACAGTATAAGCTAATAACTATAG 2094 C genome GTAGGCATTACAAGTTTTTTTGTGAAATGGGCGGACCACAGTATAAGCTAATAACTATAG 2100 D genome GTAGGCATTACAAGTTTTTTTGTGAAATGGGCGGACCACAGTATAAGCTAATAACTATAG 2100 E genome GTAGGCATTACAAGTTTTTTTGTG AATAACTATAG 2094 G genome GTAGGCATTACAAGTTTTTTTGTG CACAGTATAAGCTAATAACTATAG 2100 G genome GTAGGCAT AAATGGGCGGACCACAGTATAAGCTAATAACTATAG 2100 Gossyp kirkii GTAGGCATTACAAGTTTTTTTGTGAAATGGGCGGACCAGAGTATAAGCTAATAACTATAG 2100 Kokia drynar GTAGGCATTACAAGTTTTTTTGTGAAATGGGCGGACCACAGTATAAGCTAATAACTATAG 2100 2110 2120 2130 2140 2150 2160 A genome CACTAATAACCAACTCATCGCTTCGGATTATCTGGATCCAAAGAATCAGTCAAGATATGA 2154 B genome CACTAATAACCAACTCATCGCTTCGGATTATCTGGATCCAAAGAATCAGTCAAGATATGA 2154 C genome CACTAAGAACCAACTCATCGCTTCGGATTATCTGGATCCAAAGAATCAGTCAAGATATGA 2160 D genome CACTAATAACCAACTCATCGCTTCGGATTATCTGGATCCAAAGAATCAGTCAAGATATGA 2160 E genome CACTAATAACCAACTCATCGCTTCGGATTATCTGGATCCAAAGAATCAGTCAAGATATGA 2154 G genome CACTAATAACCAACTCATCGCTTCGGATTATCTGGATCCAAAGAATCAGTCAAGATATGA 2160 G genome CACTAAGAACCAACTCATCGCTTCGGATTATCTGGATCCAAAGAATCAGTCAAGATATGA 2160 Gossyp kirkii CACTAATAACCAACTCATCGCTTCGGATTATCTGGATCCAAAGAATCAGTCAAGATATGA 2160 Kokia drynar CACTAATAACCAACTCATCGCTTCGGATTATCTGGATCCAAAGAATCAGTCAAGATATGA 2160 2170 2180 2190 2200 2210 2220 A genome TATATTGGTCATATCATTATAGCAACTGAATTTTTTTT GCATTAAGTAAAAGACAAAAC 2213 B genome TATATTGGTCATATCATTATAGCAACTGAATCTTTTTT GCATTAAGGAAAAGACAAAAC 2213 C genome TATATTGATCATATCATTATAGCAACTGAATTTTTTT GCATTAAGTAAAAGACAAAAC 2218 D genome TATATTGGTCATATCATTATAGCAACTGAATTTTTTTT GCATTAAGTAAAAGACAAAAC 2219 E genome TATATTGGTCATATCATTATAGCAACTGAATTTTTTTTTGCATTAAGTAAAAGACAAAAC 2214 G genome TATATTGGTCATATCATTATAGCAACTGAATTTTTTTT GCATTAAGTAAAAGACAAAAC 2219 G genome TATATTGGTCATATCATTATAGCAACTGAATTTTTTT GCATTAAGTAAAAGACAAAAC 2218 Gossyp kirkii TATCTTGGTCATATCATTATAGCAACTGAATTTTTTTT GCATTAAGTAAAAGACAAAAC 2219 Kokia drynar TATCTTGGTCATATCATTATAGCAACTGAATTTTTTTT GCATTAAGTAAAAGACAAAAC 2219 2230 2240 2250 2260 2270 2280 A genome CAATCTGATTATGAATAGATCGAAATTGTGAAGCAAAATAAAAAGTATGTGGATAAATAG 2273 B genome CAATCTGATTATGAATAGATCGAA GAAGCAAAATAAAAAGTATGTGGATAAATAG 2268 C genome CAATCTGATTATGAATAGATCGAAATTGTGAAGCAAAATAAAAAGTATGTGGATAAATAG 2278 D genome CAATCTGATTATGAATAGATCGAAATTGTGAAGCAAAATAAAAAGTATGTGGATAAATAG 2279 E genome CAATCTGATTATGAATAGATCGAAATTGTGAAGCAAAATAAAAAGTATGTGGATAAATAG 2274 G genome CAATCTGATTATGAATAGATCGAAATTGTGAAGCAAAATAAAAAGTATGTGGATAAATAG 2279 G genome CAATCTGATTATGAATAGATCGAAATTGTGAAGCAAAATAAAAAGTATGTGGATAAATAG 2278 Gossyp kirkii CAATCTGATTATGAATAGATCGAAATTGTGAAGCAAAATAAAAAGTATGTGGATAAATAG 2279 Kokia drynar CAATCCGATTATGAATAGATCGAAATTGGGAAGCAAAATAAAAAGTATGTGGATAAATAG 2279 2290 2300 2310 2320 2330 2340 A genome AAGGATGAGAGAAAGAGAGAAACAGAAATAGCAATGAAATGATATAGGATTCCAATATGT 2333 B genome AAGGATGAGAGAAAGAGAGAACCAGAAATAGCAATGAAATGATATAGGATTCCAATATGT 2328 C genome AAGGATGAGAGAAAGAGAGAAACAGAAATAGCAATGAAATGATATAGGATTC AATATGT 2337 D genome AAGGATGAGAGAAAGAGAGAAACAGAAATAGCAATGAAATGACATAGGATTCCAATATGT 2339 E genome AAGGATGAGAGAAAGAGAGAAACAGAAATAGCAATGAAATGATATAGGATTCCAATATGT 2334 G genome AAGGATGAGAGAAAGAGAGAAACAGAAATAGCAATGAAATGATATAGGATTCCAATATGT 2339 G genome AAGGATGAGAGAAAGAGAGAAACAGAAATAGCAATGAAATGATATAGGATTC AATATGT 2337 Gossyp kirkii AAGGATGAGAGAAAGCGAGAAACAGAAATAGCAATGAAATGATATAGGATTCCAATATGT 2339 Kokia drynar AAGGATGAGAGAAAGAGAGAAACAGAAATAGCAATGAAATGATATAGGATTCCAATATGT 2339 2350 2360 2370 2380 2390 2400 A genome AAGGTCTATGAAGCATCTCATAAAGAGCA ATGTAATAGAGCATCAATAGAGATTCATCA 2392 B genome AAGGTCTATGAAGCATCTCATAAAGAGCA ATGTAATAGAGCATCAATAGAGATTCATCA 2387 C genome AAGGTCTATGAAGCATCTCATAAAGAGCA ATGTAATAGAGCATCAATAGAGATTCATCA 2396 D genome AAGGTCTATGAAGCATCTCATAAAGAGCA ATGTAATAGAGCATCAATAGAGATTCATCA 2398 E genome AAGGTCTATGAAGCATCTCATAAAGAGCA ATGTAATAGAGCATCAATAGAGATTCATCA 2393 G genome AAGGTCTATGAAGCATCTCATAAAGAGCATATGTAATAGAGCATCAATAGAGATTCATCA 2399 G genome AAGGTCTATGAAGCATCTCATAAAGAGCA ATGTAATAGAGCATCAATAGAGATTCATCA 2396 Gossyp kirkii AAGGTCTATGAAGCATCTAATAAAGAGCA ATGTAATAGAGCATCAATAGAGATTCATCA 2398 Kokia drynar AAGGTCTATGAAGCATCTAATAAAGAGCA ATGTAATAGAGCATCAATAGAGATTCATCA 2398 2410 2420 2430 2440 2450 2460 A genome ATAATTAGATGAATATCTGTTCATTGAAGAAAAAATCAAGAGCCTTAACTTAAGTCAATA 2452 B genome ATAATTAGATGAATATCTGTTCATTGAAGAAAAAATCAAGAGCCTTAACTTAAGTCAATA 2447 C genome ATAATTAGATGAATATCTGTTCATTGAAGAAAAAATCAAGAGCCTTAACTTAAGTCAATA 2456 D genome ATAATTAGATGAATATCTGTTCATTGAAGAAAAAATCAAGAGCCTTAACTTAAGTCAATA 2458 E genome ATAATTAGATGAATATCTGTTCATTGAAGAAAAAATCAAGAGCCTTAACTTAAGTCAATA 2453 G genome ATAATTAGATGAATATCTGTTCATTGAAGAAAAAATCAAGAGCCTTAACTTAAGTCAATA 2459 G genome ATAATTAGATGAATATCTGTTCATTGAAGAAAAAATCAAGAGCCTTAACTTAAGTCAATA 2456 Gossyp kirkii ATAATTAGATGAATATCTGTTCATTGAAGAAAAAATCAAGAGCCTTAACTTAAGTCAATA 2458 Kokia drynar ATAATTAGATGAATATCTGTTCATTGAAGAAAAAATCAAGAGCCTTAACTTAAGTCAATA 2458 2470 2480 2490 2500 2510 2520 A genome AAGACTGAGAAGGTTGACTCAAGAAAGAAATTTT ATTT TTA TT 2495 B genome AAGACTGAGAAGGTTGACTCAAGAAC AAATTTT ATTT TTA TT 2489 C genome AAGACTGAGAAGGTTGACTCAAGAAC AAATTTT ATTT TTA TT 2498 D genome AAGACTGAGAAGGTTGACTCAAGAAC AAATTTT ATTT TTA TT 2500 E genome AAGACTGAGAAGGTTGACTCAAGAAC AAATTTT ATTT TTA TT 2495 G genome AAGACTGAGAAGGTTGACTCAAGAA GAAATTT CATTT TT TT 2500 G genome AAGACTGAGAAGGTTGACTCAAGAAC AAATTTTTATTT TTA TT 2499 Gossyp kirkii AAGACTGAGAAGGTTGACTCAAGAAC AAATTTT ATTTCATTTTAA TT 2505 Kokia drynar AAGACTGAGAAGGTTGACTCAAGAAC AAATTTG ATTTCATTTTTATTTCATTTTTATT 2516 2530 2540 2550 2560 2570 2580 A genome TTATTAAATAAATATTAAAT TAAAAAATTAAATTAAT AAATATTA 2540 B genome TTATTAAATAAATAG AAATATAAA 2513 C genome TTATTAAATAAATAGT AAAATTTAA 2523 D genome TTATTAAATAAATAG AA 2517 E genome TTATTAAATAAATAG AA 2512 G genome TTATTAAATAAATATTAAAT TA AAATATTAA 2531 G genome TTATTAAATAAATAGAAA 2517 Gossyp kirkii TTATTAAATAAATAGTA AAAAAATAA 2531 Kokia drynar TTATTAAATAAATATTAAATATTAAATATTAAATATTAAATATTAAATATTAAATATTAA 2576 2590 2600 2610 2620 2630 2640 A genome ATAAATTAAGGCTCCATTGGAGAATTCAGACCTAAGCATTAATCGAGAGCGATGGGG 2597 B genome AT TTAAATTAAGGCTCCATTGGAGAATTCAGACCTAAGCATTAATCGAGAGCGATGGGG 2572 C genome ATTTTATATTAAGGCTCCATTGGAGAATTCAGACCTAAGCATTAATCGAGAGCGATGGGG 2583 D genome ATATTAAATTAAGGCTCCATTGGAGAATTCAGACCTAAGCATTAATCGAGAGCGATGGGG 2577 E genome ATATAAAATTAAGGCTCCATTGGAGAATTCAGACCTAAGCATTAATCGAGAGCGATGGGG 2572 G genome ATTAAAAATGAAGGCTCCATTGGAGAATTCAGACCTAAGCATTAATCGAGAGCGATGGGG 2591 G genome TTAAATTAAGGCTCCATTGGAGAATTCAGACCTAAGCATTAATCGAGAGCGATGGGG 2574 Gossyp kirkii ATATTAAATTAAGGCTCCATTGGAGAATTCAGACCTAAGCATTAATCGAGAGCGATGGGG 2591 Kokia drynar ATATTAAATTAAGGCTCCATTGGAGAATTCAGACCTAAGCATTAATCGAGAGCGATGGGG 2636 2650 2660 2670 2680 2690 2700 A genome ACGACGGAACCCGTGAATGCAGAG ATTCTAT TGAAAACGAATCCTAATGATT 2649 B genome ACGACGGAACCCGTGAATGCGGAGGATTCTAT TGAAAACGAATCCTAATGATT 2625 C genome ACGACGGAACCCGTGAATGCGGAGGATTCTATTGAAAACTGAAAACGAATCCTAATGATT 2643 D genome ACGACGGAACCCGTGAATGCGGAGGATTCTAT TGAAAACGAATCCTAATGATT 2630 E genome ACGACGGAACCCGTGAATGCGGAGGATTCTAT TGAAAACGAATCCTAATGATT 2625 G genome ACGACGGAACCCGTGAATGCGGAGGATTCTAT TGAAAACGAATCCTAATGATT 2644 G genome ACGACGGAACCCGTGAATGCGGAGGATTCTAT TGAAAACGAATCCTAATGATT 2627 Gossyp kirkii ACGACGGAACCCGTGAATGCAGAGGATTCTAT TGAAAACGAATCCTAATGATT 2644 Kokia drynar ACGACGGAACCCGTGAATGCAGAGGATTCTAT TGAAAACGAATCCTAATGATT 2689 2710 2720 2730 2740 2750 2760 A genome TATCGGGGAGGATGGCGGAACAAACCAGAGACCACTGCATTTCTTTTTATTCTGATTCTG 2709 B genome TATCGGGGAGGATGGCGGAACAAACCAGAGACCACTGCATTTCTTTTTATTCTGATTCTG 2685 C genome TATCGGGGAGGATGGCGGAACAAACCAGAGACCACTGCATTTCTTTTTATTCTGATTCTG 2703 D genome TATCGGGGAGGATGGCGGAACAAACCAGAGACCACTGCATTTCTTTTTATTCTGATTCTG 2690 E genome TATCGGGGAGGATGGCGGAACAAACCAGAGACCACTGCATTTCTTTTTATTCTGATTCTG 2685 G genome TATCGGGGAGGATGGCGGAACAAACCAGAGACCACTGCATTTCTTTTTATTCTGATTCTG 2704 G genome TATCGGGGAGGATGGCGGAACAAACCAGAGACCACTGCATTTCTTTTTATTCTGATTCTG 2687 Gossyp kirkii TATCGGGGAGGATGGCGGAACAAACCAGAGACCACTGCATCTCTTTTTATTCTGATTCTG 2704 Kokia drynar TATCGGGGAGGATGGCGGAACAAACCAGAGACCACTGCATCTCTTTTTATTCTGATTCTG 2749 2770 2780 2790 2800 2810 2820 A genome AGAGGTCATGGGTTAACCCGACAACTGAACTAGAAAAAGAGTAAATATTCGCCCGCGAAA 2769 B genome AGAGGTCATGGGTTAACCCGACAACTGAACTAGAAAAAGAGTAAATATTCGCCCGCGAAA 2745 C genome AGAGGTCATGGGTTAACCCGACAACTGAACTAGAAAAAGAGTAAATATTCGCCCGCGAAA 2763 D genome AGAGGTCATGGGTTAACCCGACAACTGAACTAGAAAAAGAGTAAATATTCGCCCGCGAAA 2750 E genome AGAGGTCATGGGTTAACCCGACAACTGAACTAGAAAAAGAGTAAATATTCGCCCGCGAAA 2745 G genome AGAGGTCATGGGTTAACCCGACAACTGAACTAGAAAAAGAGTAAATATTCGCCCGCGAAA 2764 G genome AGAGGTTATGGGTTAACCCGACAACTGAACTAGAAAAAGAGTAAATATTCGCCCGCGAAA 2747 Gossyp kirkii AGAGGTCATGGGTTAACCCGACAACTGAACTAGAAAAAGAGTAAATATTCGCCCGCGAAA 2764 Kokia drynar AGAGGTCATGGGTTAACCCGACAACTGAACTAGAAAAAGAGTAAATATTCGCCCGCGAAA 2809 2830 2840 2850 2860 2870 2880 A genome ATTTGAGTTTAATT TGATTGTTCAATTTTTGTCGATCTGAATCTGATATGAATAT 2824 B genome ATTTGAGTTTAATTTTATTTGATTGTTCAATTTTTGTCGATCTGAATCTGATATGAATAT 2805 C genome ATTTGAGTTTAATTTTATTTGATTGTTCAATTTTTGTCGATCTGAATCTGATATGAATAT 2823 D genome ATTTGAGTTTAATTTTATTTGATTGTTCAATTTTTGTCGATCTGAATCTGATATGAATAT 2810 E genome ATTTGAGTTTCATTTTATTTGATTGGTCAATTTTTGTCGATCTGAATCTGATATGAATAT 2805 G genome ATTTGAGTTTAATTTTATTTGATTGTTCAATTTTTGTCGATCTGAATCTGATATGAATAT 2824 G genome ATTTGAGTTTAATTTTATTTGATTGTTCAATTTTTGTCGATCTGAATCTGATATGAATAT 2807 Gossyp kirkii ATTTGAGTT AATTTTATTTGATTGTTCAATTTTTGTCGATCTGAATCTGATATGAATAT 2823 Kokia drynar ATTTGAGTT AATTTTATTTGATTGTTCAATTTTTGTCGATCTGAATCTGATATGAATAT 2868 2890 2900 2910 2920 2930 2940 A genome GATAAAAAACAAAATAAAGATTCGTTATAACATTATAACAAAACCAAGATAAGACATTAT 2884 B genome GATAAAAAACAAAATAAAGATTCGTTATAACATTATAACAAAACCAAGATAAGACATTAT 2865 C genome GATAAAAAACAAAATAAAGATTCGTTATAACATTATAACAAAACCAAGATAAGACATTAT 2883 D genome GATAAAAAACAAAATAAAGATTCGTTATAACATTATAACAAAACCAAGATAAGACATTAT 2870 E genome GATAAAAAACAAAATAAAGATTCGTTATAACATTATAACAAAACCAAGATAAGACATTAT 2865 G genome GATAAAAAACAAAATAAAGATTCGTTATAACATTATAACAAAACCAAGATAAGACATTAT 2884 G genome GATAAAAAACAAAATAAAGATTCGTTATAACATTATAACAAAACCAAGATAAGACATTAT 2867 Gossyp kirkii GATAAAAAACAAAATAAAGATTCGTTATAACATTATAACAAAAGCAAGATAAAACATTAT 2883 Kokia drynar GATAAAAAACAAAATAAAGATTCGTTATAACATTATAACAAAAGCAAGATAAAACATTAT 2928 2950 2960 2970 2980 2990 3000 A genome CTAGAAATAGAATCCGTGTTTAATTCCTTATACTTATATATATATCCAATAGATCCAAAC 2944 B genome CTAGAAATAGAATCCGTGTTTAATTCCTTATACT TATATATATCCAATAGATCCAAAC 2923 C genome CTAGAAATAGAATCCGTGTTTAATTCCTTATACT TATATATCCAATAGATCCAAAC 2939 D genome CTAGAAATAGAATCCGTGTTTAATTCCTTATACT TATATATATCCAATAGATCC AAC 2928 E genome CTAGAAATAGAATCCGTGTTTAATTCCTTATATTTATATATATATCCAATAGATCCAAAC 2925 G genome CTAGAAATAGAATCCGTGTTTAATTCCTTATACTTATATATATATCCAATAGATCCAAAC 2944 G genome CTAGAAATAGAATCCGTGTTTAATTCCTTATACT TATATATCCAATAGATCCAAAC 2923 Gossyp kirkii CTAGAAATAGAATCCGTGTTTAATTCC TTATATATATATCCAATATATCCAAAC 2937 Kokia drynar CTAGAAATAGAATCCGAGTTTAATTCC TTATATATATATCCAATATATCCAAAC 2982 3010 3020 3030 3040 3050 3060 A genome AAGATATACAAATTTCTAATAGATCAGATAAAATCGCAAAGCAAAGAATCCCAAGATTCA 3004 B genome AAGATATACAAATTTCTAATAGATCAGATAAAATCGCAAAGCAAAGAATCCCAAGATTCA 2983 C genome AAGACATACAAATTTATAATAGATCAGATAAAATCGCAAAGCAAAGAATCCAAAGATTCA 2999 D genome AAGATATACAAATTTCTAATAGATCAGATAAAATCGCAAAGCAAAGAATCCCAAGATTCA 2988 E genome AAGATATACAAATTTATAATAGATCAGATAAAATCGCAAAGCAAAGAATCCCAAGATTCA 2985 G genome AAGATATACAAATTTCTAATAGATCAGATAAAATCGCAAAGCAAAGAATCCCAAGATTCA 3004 G genome AAGATATACAAATTTATAATAGATCAGATAAAATCGCAAAGCAAAGAATCCCAAGATTCA 2983 Gossyp kirkii AAGATAGACAAATTTCTAATAGATCAGATAAAATCTCAAAGCAAAGAATCCCAAGATTCT 2997 Kokia drynar AAGATATACAAATTTCTAATAGATCAGATAAAATCTCAAAGCAAAGAATCCCAAGATTCT 3042 3070 3080 3090 3100 3110 3120 A genome ATTATTCATTAACTACCCGTATATCTTAAGATTAAGAATTAAATATTTTTTTATTCATTT 3064 B genome ATTATTCATTAACTACCTGTATATCTTAAGATTAAGAATTAAATATTTTTTTAGTCATTT 3043 C genome ATTATTCATTAACTACCTGTATATCTTAAGATTAAGAATTAAATATTTTTTTAGTCATTT 3059 D genome ATTATTCATTAACTACCTGTATATCTTAAGATTAAGAATTAAATATTTTTTTAGTCATTT 3048 E genome ATTATTCATT CTGTATATCTTAAGATTAAGAATTAAATATTTTTTTATTCATTT 3039 G genome ATTATTCATTAACTACCTGTATATCTTAAGATTAAGAATTAAATATTTTTTTATTCATTT 3064 G genome ATTATTCATTAACTACCTGTATATCTTAAGATTAAGAATTAAATATTTTTTTAGTCATTT 3043 Gossyp kirkii ATTATTCATTAACTACCTGTATATCTTAAGATTAAGAATAAAATATTTTTTTAGTCATTT 3057 Kokia drynar ATTATTCATTAACTACCTGTATATCTTAAGATTAAGAATAAAATATTTTTTTAGTCATTT 3102 3130 3140 3150 3160 3170 3180 A genome TTTTTTT CGCGAGGAGCTGGATGAGAAGAAACTCTCATGTCCAGTTCTGTAGTAGAGAT 3123 B genome TTTTTT CGCGAGGAGCTGGATGAGAAGAAACTCTCATGTCCAGTTCTGTAGTAGAGAT 3101 C genome TTTTTT CGCGAGGAGCTGGATGAGAAGAAACTCTCATGTCCAGTTCTGTAGTAGAGAT 3117 D genome TTTTTTTTCGCGAGGAGCTGGATGAGAAGAAACTCTCATGTCCAGTTCTGTAGTAGAGAT 3108 E genome TTTTTTT CGCGAGGAGCTGGATGAGAAGAAACTCTCATGTCCAGTTCTGTAGTAGAGAT 3098 G genome TTTTT CGCGAGGAGCTGGATGAGAAGAAACTCTCATGTCCAGTTCTGTAGTAGAGAT 3121 G genome TTTTT CGCGAGGAGCTGGATGAGAAGAAACTCTCATGTCCAGTTCTGTAGTAGAGAT 3100 Gossyp kirkii TTTTTT CGCGAGGAGCTGGATGAGAAGAAACTCTCATGTCCAGTTCTGTAGTAGAGAT 3115 Kokia drynar TTTTTTT CGCGAGGAGCTGGATGAGAAGAAACTCTCATGTCCAGTTCTGTAGTAGAGAT 3161 3190 3200 3210 3220 3230 3240 A genome GGAATTCATAAACAACAACCATCAACTATAACCCCAAAAGATAGAAATTTGGTATCCATA 3183 B genome GGAATTCATAAACAACAACCATCAACTATAACCCCAAAAGATAGAAATTTTGTATCCATA 3161 C genome GGAATTCATAAACAACAACCATCAACTATAACCCCAAAAGATAGAAATTTTGTATCCATA 3177 D genome GGAATTCATAAACAACAACCATCAACTATAACCCCAAAAGATAGAAATTTGGTATTCATA 3168 E genome GGAATTCATAAACAACAACCATCAACTATAACCCCAAAAGATAGAAATTTGGTATCCATA 3158 G genome GGAATTCATAAACAACAACCATCAACTATAACCCCAAAAGATAGAAATTTGGTATCCATA 3181 G genome GGAATTCATAAACAACAACCATCAACTATAACCCCAAAAGATAGAAATTTTGTATCCATA 3160 Gossyp kirkii GGAATTCATAAACAA AC ATCAACTATAACCCCAAAAGATAGAAATTT 3162 Kokia drynar GGAATTCATAAACAA AC ATCAACTATAACCCCAAAAGA GAAATTTTGTATCCATA 3218 3250 3260 3270 3280 3290 3300 A genome GGGATTCAGCAAACTATTAG ATCTTATCTATT AACTATCTATTAGTTA 3231 B genome GGGATTCAGCAAACTATTAGGATCTTATCTATT AACTATCTATTAGTTA 3210 C genome GG ATTCAGCAAACTATTAGGATCTTATCTATT AACTATCTATTAGTTA 3225 D genome GGGATTCAGCAAACTATTAGGATCTTATCTATT AACTATCTATTAGTTA 3217 E genome GGGATTCAGCAAACTATTAGGATCTTATCTATT AACTGTCTATTAGTTA 3207 G genome GGGATTCAGCAAACTATTAG ATCTTATCTATT AACTATCTATTAGTTA 3229 G genome GGGATTCAGCAAACTATTAGGATCTTATCTATT AACTATCTATTAGTTA 3209 Gossyp kirkii AGACTCGAATTTACTATCTATTAGTTA 3189 Kokia drynar GGGATTCAGCAAACTATTAGGATCTTATCTATT AACTATCTATTAGTTA 3267 3310 3320 3330 3340 3350 3360 A genome TTCATAATTAATATGAATTATTAATATGAATTAGAGACTCGAATTTAGAAAAACTAGAAT 3291 B genome TTCATAATTAATATGAATTATTAATATGAATTATAGACTCGAATTTAGAAAAACTAGAAT 3270 C genome TT ATAATTAATATGAATTATTAATATGAATTATAGACTCGAATTTAGAAAAACTAGAAT 3284 D genome TTCATAATTAATATGAATTATTAATATGAATTATAGACTCGAATTTTGA TAGAAT 3272 E genome TTCATAATTAATATGAATTCTTAATATGAATTATAGACTCGAATTTAGAAAAACTAGAAT 3267 G genome TTCATAATTAATATGAATTAGTAATATGAATTATAGACTCGAATTTAGAAAAACTAGAAT 3289 G genome TTCATAATTAATATGAATTATTAATATGAATTATATACTCGAATTTAGAAAAACTATAAT 3269 Gossyp kirkii TTCATAATTAATATGAATTATTAATATGAATTATAGACTCGAATTTAGAAAAACTAGAAT 3249 Kokia drynar TTCATAATTAATATGAATTATTAATATGAATTATAGACTCGAATTTAGAAAAACTAGAAT 3327 3370 3380 3390 3400 3410 3420 A genome TTTTTCTAATTTTTAATGCCATACTTAATATAAACTTAATATAAATATA ACA 3343 B genome TTTTTCTAATTTTTAATGCCATAC TTAATATAAATATATAAATATAACA 3319 C genome TTTTTTTAATTTTTAACGCCATACTTAATATAA CTTAATATAAATATATAAATATAACA 3343 D genome TTTTTCTAATTTTTAATGCCATAC TTAATATAAATATATAAATATAACA 3321 E genome TTTTTCTAAATTTTAATGCCATAC TTAATATAAATATATAAATATAACA 3316 G genome TTTTTATAATTTTTAATGCCATACTTAATGTAAACTTAATATAAATATATAAATATAACA 3349 G genome TTTTTCTAATTTTTAACGCCATAC TTAATATAAATATATAAATATAACA 3318 Gossyp kirkii TATTTTTAATTTTTAATGCCA TAATATAATTATA ACA 3286 Kokia drynar TATTTCTAATTTTGAATGCCATAC TTAATATAAATATA ACA 3368 3430 3440 3450 3460 3470 3480 A genome TATTTAATATAATA ATGGTAGATTCAATCTAATATTCAAGCTAATGTTGATAGAA 3398 B genome TATTTAATATAATA ATGGTAGATTCAATCTAATATTCAAGCTAATGTTGATAGAA 3374 C genome TATTTAATATAATA ATGGTAGATTCAATCTAATATTCAAGCTAATGTTGATAGAA 3398 D genome TATTTAATATAATA ATGGTAGATTCAATCTAATATTCAAGCTAATGTTGATAGAA 3376 E genome TATTAAATATAATA ATGGTAGATTCAATCTAATATTCAAGCTAATGTTGATAGAA 3371 G genome TATTTAATATAATA ATGGTAGATTCAATCTAATATTCAAGCTAATGTTGATAGAA 3404 G genome TATTTAATATAATA ATGGTAGATTCAATCTAATATTCAAGCTAATGTTAATAGAA 3373 Gossyp kirkii TATTTAATATAATATAATAATGGTAGATTCAATCTAATATTCAAGCTAATGTTGATCGAA 3346 Kokia drynar TATTTAATATAATATAATAATGGTAGATTCAATCTAATATTCAAGCTAATGTTGATAGAA 3428 3490 3500 3510 3520 3530 3540 A genome TCTAATA CGATTTAAATT 3416 B genome TCTAATAATTAAGAATATAATAATTCTATTTAATTT 3410 C genome TCTAATAATTAAGAATATAATAATTCTATTT 3429 D genome TCTAATAATTAAGAATATAATAATTCGATTTTAATTT 3413 E genome TCTAATAATTAAGAATATAATAATTTGATTTCATTT 3407 G genome TCTAATAATTA TAATAATTCGATTTAAATT 3434 G genome TCTAATAATTAAGAATATAATAATTCTATTTAAATT 3409 Gossyp kirkii TCTAATAGTATAG AATAATTCTATTTAATTTTATTTGATTATATTTTAATCATAT 3401 Kokia drynar TCTAATAATATAG AATAATTCTATTTAATTTTATT 3463 3550 3560 3570 3580 3590 3600 A genome 3416 B genome 3410 C genome 3429 D genome 3413 E genome 3407 G genome 3434 G genome 3409 Gossyp kirkii TAAAAATTAGATTTTAATTTAAACATAATATAATATATTATTAATAATATATAATATTAT 3461 Kokia drynar 3463 3610 3620 3630 3640 3650 3660 A genome AAAA 3420 B genome 3410 C genome 3429 D genome 3413 E genome 3407 G genome AAAAA 3439 G genome 3409 Gossyp kirkii AATTTTTAATTATAAATATAAAAATTCATTATCATTATATTATAATAATATTATAAA T 3519 Kokia drynar 3463 3670 3680 3690 3700 3710 3720 A genome TTTTATATATATATTTATTATTTATCTATATATTTTATATATTTA ATATA 3470 B genome TTTTTTATATATATATTTATTATTTATCTATATAATTTAT TATTTATCTATATA 3464 C genome TATATATATTTATTATTTATCTA TATA 3456 D genome TATATATATATATTTATTATTTATCTA TATA 3444 E genome TTTTTTATATATATATTTATTATTTCTCTA TATA 3441 G genome TTTATATATATATTTATTATTTATCTA TATA 3470 G genome ATATATATATTATTTATCTA TATA 3433 Gossyp kirkii TTTTTATAATATTATATATATTTATTATTTATCTA TATA 3558 Kokia drynar 3463 3730 3740 3750 3760 3770 3780 A genome TTTAATATCTTTTTTTATATCTTAGTTATATTTCTTTTATATTA 3514 B genome TTTAATATCTTTTTTTATATCTTAGTTATATTTCTTTTATATTA 3508 C genome TTTAATATCTTTTTTTATATCTTAGTTAGATTTCTTTTATATTA 3500 D genome TTTAATATCTTTTTTTATATCTTAGTTATATTTCTTTTATATTA 3488 E genome TTTAATATCTTTTTTTATATCTTAGTTATATTTCTTTTCTATTA 3485 G genome TTTAATATCTTTTTTTATATCTTAGTTATATTTCTTTTATATTA 3514 G genome TTTAATATCTTTTTTTATATCTTAGTTAGATTTCTTTTATATTA 3477 Gossyp kirkii TTAAATATCTTTTTTTA CTCTTAGTCGTATTTCTTTTATATTATATGTTATATTGATTT 3617 Kokia drynar 3463 3790 3800 3810 3820 3830 3840 A genome ATATAG TAATATTACTAATATTACTGACTCCATTT 3549 B genome ATATAG TAATATTACTAATATTACTGACTCCATTT 3543 C genome ATATAGTAATATAATATTACTAATATTACTGACTCCATTT 3540 D genome ATATAGTAATATAATATTACTAATATTACTGACTCCATTT 3528 E genome ATATAG TAATATTAGTAATATTACTGACTCCATTT 3520 G genome ATATAGTAATAGAATATTACTAATATTACTGACTCCCTTT 3554 G genome ATATAGTAATATAATATTACTAATATTACTGACTCCATTT 3517 Gossyp kirkii TATTAGTATATTCTATATTAATATAGTAATATAATATTATTAATATTACT ACTCCATTT 3676 Kokia drynar 3463 3850 3860 3870 3880 3890 3900 A genome TTATTTTCTAGTTTATTTTATATTTTAG TATATTTTACATCTAAATTATATAG 3602 B genome TGATTTTCGAGTTTATTTTCTATTTTAGATTTTAGTATATTTTACATCTAAATTATATAG 3603 C genome TTATTTTCGAGTTTATTTTATATTTTAGATTTTAGTATATTTTACATCTAAATTATATAG 3600 D genome TGATTTTCTAGTTTATTTTATATTTTAG TATATTTTACATCTAAATTATATAG 3581 E genome TTATTTTCTAGTTTATTTTCTATTTTAG TATATTTTACATCTAAATTATAGAG 3573 G genome TTATTTTCTAGTTTATTTTCTATTTTAG TATATTTTACATCTAAATTATATAG 3607 G genome TTATTTTCGAGTTTATTTTATATTTTAGATTTTAGTATATTTTACATCTAAATTATATAG 3577 Gossyp kirkii TTATTTTCTAGTT ATTTTATATTTTAG TATATTTTACATCTAAATTATATA 3727 Kokia drynar 3463 3910 3920 3930 3940 3950 3960 A genome AAATAGAAAATTTTTTATATAGATTTCATTTAATCGATCGATTTAATAGATTTAATCTAG 3662 B genome AAA ATTTTTTATATAGATTTCATTTAATCGATCGATTTAATAGATTTAATATAG 3657 C genome AAA TTTTTTTATATAGATTTCATTTAATCGATCGATTTAATAGATTTAATATAG 3654 D genome AAA ATTTTTTATATAGATTTCATTTAATCGATCGATTTAATAGATTTAATATAG 3635 E genome AAA ATTTTTTCTATAGATTTCATTTAATCGATCGATTTAATAGATTTAATATAG 3627 G genome AAA ATTTTTTATATAGATTTCATTTAATCGATCGATTTAATAGATTTAATATAG 3661 G genome AAA ATTTTTTATATAGATTTCATTTAATGGATCGATTTAATAGATTTAATATAG 3631 Gossyp kirkii TATATATATTTCATTTAATCCATCGATTTAATAGATTTAATATAG 3772 Kokia drynar TTTTATTTAATCGATCGATTTAATAGATTTAATATAG 3500 3970 3980 3990 4000 4010 4020 A genome ATTAGATTTATTTCTATTTAGTTTAGAGTTCTAAATAGAGATAATTAGAGTCAAAATCTT 3722 B genome ATTAAATTTTTTTCTATTTAGTTTAGAGTTATAAATAGAGATAATTAGAGTCAAAATCTT 3717 C genome ATTAAATTTTTT CTATTTAGTTTAGAGTTCTAAATAGAGATAATTAGAGTCAAAATCTT 3713 D genome ATTAAATTTATTTCTATTTAGTTTCGAGTTCTAAATAGAGATAATTAGAGTCAAAATCTT 3695 E genome ATTAAATTTATTTCTATTTAGTTTAGAGTTCTAAATAGAGATAATTAGAGTCAAAATCTT 3687 G genome ATTAAATTTATTTCTATTTAGTTTAGAGTTCTAAATAGAGATAATTAGAGTCAAAATCTT 3721 G genome ATTAAATTTTTTTCTATTTAGTTTAGAGTTCTAAATAGAGATAATTAGAGTAAAAATCTT 3691 Gossyp kirkii ATTCAATTTATTTCTATTTAGTTTAGAGTTCTAAATAGAGATAATTAGAGTCAAATTTTT 3832 Kokia drynar ATTCAATTTATTTCTATTTAGTTTAGAGTTCTAAATAGAGATAATTAGGGTCAAAATCTT 3560 4030 4040 4050 4060 4070 4080 A genome TTTATGCAGTTATATATTTTATGATTATATAAATGA AACGTTATAAGTCTAGATA 3777 B genome TTTATGCATTTATATATTTT TATATAAATGA TACGTTATAAGTCTAGATA 3767 C genome TTTATGCATTTATATATTTTATGATTATATAAATGAAATGATACGTTATAAGTCTAGATA 3773 D genome TTTATGCATTTATATATTTTATGATTCTAGAAATGAAATGATACGTTATAAGTCTAGATA 3755 E genome TTTATGCATTTATATATTTTATGATTATATAAATGAAATGATACGTTATAAGTCTAGATA 3747 G genome TTTATGCATTTATATATTTTATGATTATATAAATGAAATGATACGTTATAAGTCTAGATA 3781 G genome TTTATGCATTTATATATTTTATGATTATATAAATGAAATGATACGTTATAAGTCTAGATA 3751 Gossyp kirkii TTTATGCATTTATATATTTTATCATTATATAAATGAAATGATACGTTATAAGTCTAGATA 3892 Kokia drynar TTTATGCATTTATATATTTTATCATTATATAAATGAAATGATACGTTATAAGTCTAGATA 3620 4090 4100 4110 4120 4130 4140 A genome ATTAGAATGAAACTCTTTTTAGACTCAAAAATTTGAATTATCTTCGAATTCGAAATAGAA 3837 B genome ATTAGAATGAAACTCTTTTTAGACTCAAAAATTTGAATTATCTTCGAATTCGAAATAGAA 3827 C genome ATTAGAATGAAACTCTTTTTAGACTAAAAAATTTGAATTATCTTCGAATTCGAATTCGAA 3833 D genome ATTAGAATGAAACTCTTTTTAGACTCAAAAATTTGAATTATCTTCGAATTCGAAATAGAA 3815 E genome ATTAGAATGAAACTCTTTTTAGACTCAAAAATTTGAATTATCTTCGAATTCGAAATAGAA 3807 G genome ATTAGAATGAAACTCTTTTTAGACTCAAAAATTTGAATTATCTTCGAATTCGAAATAGAA 3841 G genome ATTAGAATGAAACTCTTTTTAGACTAAAAAATTTGAATTATCTTCGAATTCGAAATAGAA 3811 Gossyp kirkii ATTAAAATGAAACTCTTTTTAGACTTAAAAATTTGAATTATCTTCGAATTCGAAATAAAA 3952 Kokia drynar ATTAAAAAGAAACTCTTTTTAGACTCAAAAATTTGAATTATCTTCGAATTCGAAATAGAA 3680 4150 4160 4170 4180 4190 4200 A genome ATGAATGGAATAATTAGTTCTAGTTATTAAATAGAAATAATTAGTTCTAGCTATTATACT 3897 B genome ATGAATGGAATAATTAGTTCTAGTTATTAAATATAAATAATTAGTTCTAGCTATTATACT 3887 C genome ATGAATGGAATAATTAGTTCTAGTTATTAAATATAAATAATTAGTTCTAGCTATTATACT 3893 D genome ATGAATGGAATAATTAGTTCTAGTTATTAAATATAAATAATTAGTTCTAGCTATTATACT 3875 E genome ATGAATGG AATAATTAGTTCTAGCTATTATACT 3840 G genome ATGAATGGAATAATTAGTTCTAGTTATTAAATATAAATAATTAGTTCTAGCTATTATACT 3901 G genome ATGAATGGAATAATTAGTTCTAGTTATTAAATATAAATAATTAGTTCTAGCTATTATACT 3871 Gossyp kirkii ATGAATGGAATAATTAGTTCTAGTTATTAAATATAAATAATTAGTTCTAGCTATTATGCT 4012 Kokia drynar ATGAATGGAATAATTAGTTCTAGTTATTAAATAGAAATAATTAGTTCTAGCTATTATACT 3740 4210 4220 4230 4240 4250 4260 A genome ATAAAAAAAAA TAATTAATTT CATTTTCATTTTTA ATAATGAATAAA 3944 B genome ATAAAAAAAAA TAATTAATTT CATTTTCATTTTTA ATAATGAATAAA 3934 C genome ATAAAAAA TAATTAATTT CATTTTAATTTTTA ATAATGAATAAA 3937 D genome ATAAAAAAAA TAATTTATTT CATTTTTAATTTTA ATAATGAATAAA 3921 E genome ATAAAAAAAAAATAATTAATTT CATTTTCATTTTTA ATAATGAAAAAA 3888 G genome ATAAAAAAAAA TAATTAATTT CATTTTCATTTTTAATTAATGAATAAA 3949 G genome ATAAAAAAAA TAATTAATTT CATTTTTATT 3901 Gossyp kirkii ATAAAAAAA TAATTAATTT AATTTTA AATATAATAAATAAA 4053 Kokia drynar ATAAAAAAAA TAATTAATTAAAAAAAATAATTAATTTCATTTTAA TAATGAATAAA 3796 4270 4280 4290 4300 4310 4320 A genome TTCAATTTTCATTTTTATTTTTTTAGTTAT TATGGTTATATAGGATAGT 3993 B genome TTAAATTTTCATTTTTATTTTTTTAGTTATCT TATTATGGTTATATAGGATAGT 3988 C genome TTAAATTTTCATTTTTATTTTTT AGTTATCTTATTCTTATTATGGTTATATAGAATAGT 3996 D genome TTCAATTTTCATTTTGATTTTTTTAGTTATCTTATTCTTATTATGGTTATATAGGATGGT 3981 E genome TTCAATTTTCATTTTTATTTTTTTAGGTATCTTATTCTTATTATGGTTATATAGGATAGT 3948 G genome TTCAATTTTCATTTTTATTTTTTTAGTTATCTTATTCTTATTATGGTTATATAGGATAGT 4009 G genome TTTTTTTAGTTATCTTATTCTTATTATGGTTATATAGGATAGT 3944 Gossyp kirkii TTCAATTTTTATTTTTATTGTTTTAGTTATCTTATTCTTATATAGG ATAG T 4104 Kokia drynar TTAAATTTTCATTTTTATTTTTTTAGTTATCTTATTCTTATTATGGTTATATAGGATAGT 3856 4330 4340 4350 4360 4370 4380 A genome CTAATAA TAAGAATAAAAATGAAATTAAAGAAAAAAAGATGCAACCCATA 4043 B genome CTAATAAAA GGATAAGAATAAAAATGAAATTAAAGAAAAAAAGATGCAACCCATA 4043 C genome CTAATAAAA GGATAAGAATAAAAATTAAATTAAAGAAAAAAAGATGCAACCCATA 4051 D genome CTAATAAAAGGAAAGGATAAGAATCAAAATGAAATTAAAGAAAAAAAGATGCAACCCATA 4041 E genome CTAATAAAA GGATAAGAATAAAAATGAAATTAAAGAAAAAAAGATGCAACCCATA 4003 G genome CTAATAAAA GGATAAGAATAAAAATGAAATTAAAGAAAAAAAGATGCAACCCATA 4064 G genome CTAATAAAA GGATAAGAATAAAAATTAAATTAAAGAAAAAAAGATGCAACCCATA 3999 Gossyp kirkii CTAATAAAA GGATAAGAATAAAAATGAAATTAAAGAAAAAAAGATTCAACCCATA 4159 Kokia drynar CTAATAAAA GGATAAGAATAAAAATGAAATTAAAGAAAAAAAGATGCAACCCATA 3911 4390 4400 4410 4420 4430 4440 A genome GAAATGAAATCCAGATCATAATGAGAGACTCCTTTCTTTTGTTTTCATTCATAAAGACAG 4103 B genome GAAATGAAATCCAGATCATAATGAGAGACTCCTTTCTTTTGTTTTCATTCATAAAAACAG 4103 C genome GAAATGAAATCCATATCATAATGAGAGACTCCTTTCTTTTGTTTTCATTCATAAAGACAG 4111 D genome GAAATGAAATCCAGATCATAATGAGAGACTCCTTTCTTTTGTTTTCATTCATAAAGACCG 4101 E genome GAAATGAAATCCAGATCATAATGAGAGACTCCTTTCTTTTGTTTTCATTCATAAAGACAG 4063 G genome GAAATGAAATCCAGATCATAATGAGAGACTCCTTTCTTTTGTTTTCATTCATAAAGACAG 4124 G genome TAAATGAAATCCAGATCATAATGAGAGACTCCTTTCTTTTGTTTTCATTCATAAAGACAG 4059 Gossyp kirkii GAAATGAAATCCAGATCATAATGAGAGACTCCTTTCTTTTGTTTTCATTCATAAAGACAA 4219 Kokia drynar GAAATGAAATCCAGATCATAATGAGAGACTCCTTTCTTTTGTTTTCATTCATAAAGACAA 3971 4450 4460 4470 4480 4490 4500 A genome AAGCTAAGACGAAAAAAAGAATCGACCCTTCGAGTATTCCACCAAATTGCCTGAGGAAAC 4163 B genome AAGCTAAGACGAAAAAAAGAATCGACCGTTCGAGTATTCCACCAAATTGCCTGAGAAAAC 4163 C genome AAGCTAAGACGAAAAAAAGAATCGACCGTTCGAGTATTCCACCAAATTGCCTGAGAAAAC 4171 D genome AAGCTAAGACGAAAAAAAGAATCGACCCTTCGAGTATTCCACCAAATTGCCTGAGAAAAC 4161 E genome AAGCTAAGACGAAAAAAAGAATCGACCCTTCGAGTATTCCACCAAATTGCCTGAGAAAAC 4123 G genome AAGCTAAGACGAAAAAAAGAATCGACCCTTCGAGTATTCCACCAAATTGCCTGAGAAAAC 4184 G genome AAGCTAAGACGAAAAAAAGAATCGACCGTTCGAGTATTCCACCAAATTGCCTGAGAAAAC 4119 Gossyp kirkii AAGCTAAGACGAAAAAAAAAATCGACCGTTCGAATATTCCACCAAATTGTCTGAGAAAAC 4279 Kokia drynar AAGCTAAGACGAAAAAAAGAATCGACCGTTCGAGTATTCCACCAAATTGTCTGAGAAAAC 4031 4510 4520 4530 4540 4550 4560 A genome TGAGAGTAAGAGGGACATGTATATGTTATGAAATACCCATCTATATTGAATTGCGAATAC 4223 B genome TGAGAGTAAGAGGGACATATATATGTTATGGAATACCCATCTATATTGAATTGCGAATAC 4223 C genome TGAGAGTAAGAGGGACATATATATGTTATGGAATACCCATCTATATTGAATTGCGAATAC 4231 D genome TGAGAGTAAGAGGGACATATATATGTTATGGAATACCCATCTATATTGAATTGCGAATAC 4221 E genome TGAGAGTAAGAGGGACATATATATGTTATGGAATACCCATCTATATTGAATTGCGAATAC 4183 G genome TGAGAGTAAGAGGGACATATATATGTTATGGAATACCCATCTATATTGAATTGCGAATAC 4244 G genome TGAGAGTAAGAGGGACATATATATGTTATGGAATACCCATCTATATTGAATTGCGAATAC 4179 Gossyp kirkii TGGGAGTAAGAGGAACATATATATGTTATGGAATACCCATCTATATTGAATTGTGAATAC 4339 Kokia drynar TGGGAGTAAGAGGGACATATATATGTTATGGAATACCCATCTATATTGAATTGCGAATAC 4091 4570 4580 4590 4600 4610 4620 A genome AGAAAT GATAAAATATTTT TGGACCAAATAAAAATTAATATGGGTCTCCGATAG 4277 B genome AGAAAT GATAAAATATTTTCTGATTGGACCAAATAAAAATGAATATGGGTCTCCGATAG 4282 C genome AGAAAT GATAAAATATTTTCTGATTGGACCAAATAAAAATTAATATGGGTCTCCGATAG 4290 D genome AGAAAT GATAAAATATTTTCCGATTGGACCAAATAAAAATTAATATGGGTCTCCGATAG 4280 E genome AGAAAT GATAAAATATTTTCTGATTGGACCAAATAAAAATTAATAGGGGTCTCCGATAG 4242 G genome AGAAAT GATAAAATATTTTCTGATTGGACCAAATAAAAATTAATATGGGTCTCCGATAG 4303 G genome AGAAAT GATAAAATATTTTCTGATTGGACCAAATAAAAATTAATATGGGTCTCCGATAG 4238 Gossyp kirkii AGAAAT AGTAAAATATTTTCTGATTGGACCAAATAAAAATAAATATGGGTCTACGGTAG 4398 Kokia drynar AGAAAT GATAAAATATTTT TGGACCAAATAAAAATAAATATGGGTCTCCGATAG 4145 4630 4640 4650 4660 4670 4680 A genome AGACGAAAAACGGATAAACAAACAAGAAAATAGGTAAAGACCCTTCGATATAAGAATCTG 4337 B genome AGACGAAAGACG ATAAACAAACAAGAAAATAGGTAAAGACCCTTCGATATAAGAATCTG 4341 C genome AGACGAAAGACG ATAAACAAACAAGAAAATAGGTAAAGACCCTTCGATATAAGAATCTG 4349 D genome AGACGAAAGACG ATAAACAAACAAGAAAATAGGTAAAGACCCTTCGATATAAGAATCTG 4339 E genome AGACGAAAGACG ATAAACAAACAAGAAAATAGGTAAAGACCCTTCGATATAAGAATCTG 4301 G genome AGACGAAAGACGGATAAACAAACAAGAAAATAGGTAAAGACCCTTCGATATAAGAATCTG 4363 G genome AGACGAAAGACG ATAAACAGACAAGAAAATAGGTAAAGACCCTTCGATATAAGAATCTG 4297 Gossyp kirkii AGACGAAAGATG ATAAACAAACAAGAAAATAGGTAAAGACCCTTCGATATAAGAATCTG 4457 Kokia drynar AGACGAAAGACG ATAAACAAACAAGAAAATAGGTAAAGACCCTTCGATATAAGAATCTG 4204 4690 4700 4710 4720 4730 4740 A genome TATCTATATCTACTAAATTCAACGGTTTCGCATAAAAAGAAAGCAAATAAATAAACGAAA 4397 B genome TATCTATATCTACTAAATTCAACGATTTCGCATAAAAAGAAAGCAAAT 4389 C genome TATCTATATCTACTAAATTCAACGGTTTCGCATAAAAAGAAAGCAAATAAATAAACGAAA 4409 D genome TATCTATATCTACTAAATTCAACGGTTTCGCATAAAAAGAAAGCAAATAAATAAACGAAA 4399 E genome TATCTATATCTACTAAATTCAACGGTTTCGCATAAAAAGAAAGCAAATAAATAAACGAAA 4361 G genome TATCTATATCTACTAAATTCAACGGTTTCGCATAAAAAGAAAGCAAATAAATAAACGAAA 4423 G genome TATCTATATCTACTAAATTCAACGGTTTCGCATAAAAAGAAAGCAAATAAATAAACGAAA 4357 Gossyp kirkii TATCTATATCTACTAAATTCAACGGTTTCGCAAAAAAAGAAAGCAAATAAATAAACAAAA 4517 Kokia drynar TATCTATATCTACTAAATTCAACGGTTTCGCATAAAAAGAAAGCAAATAAATAAACGAAA 4264 4750 4760 4770 4780 4790 4800 A genome GAAAATAAACAAATGAAAGAA GGGGGAAA GGAGGGAGA 4435 B genome AAACAAATGAAAGAA GGGGGAAAG GGGGGAAAGGAGGGAGA 4430 C genome GAAAATAAACAAATGAAAGAA GGGGGAAA GGAGGGAGA 4447 D genome GAAAATAAACAAATGAAAGAA GGGGGAAAGG GGGGGAAAGGAGGGAGA 4447 E genome GAAAATAAACAAATGAAAGAA GGGGGAAAGT GGGGGAAAGGAGGGAGA 4409 G genome GAAAATAAACAAATGAAAGAA GGGGGAAA GGAGGGAGA 4461 G genome GAAAATAAACAAATGAAAGAA GGGGGAAA 4386 Gossyp kirkii GAAAATAAACAAATGAAAGAAAGTGAAAAGAGGGGGGAAA 4557 Kokia drynar GAAAATAAACAAATGAAAGAAGGGGGAAAGAGGGGGGAAAAAAGGGGGAA GAGGGAGA 4322 4810 4820 4830 4840 4850 4860 A genome AAGGGGGAAGGAGGGGCCTAGCATCTTTTACACATTTGTATGAAGAAAGGGATTCGTTCA 4495 B genome AAGGGGGAAGGAGGGGCCTCGCATCTTTTACACATTTGTATGAAGAAAGGGATTCGTTCA 4490 C genome AAGGGGGAAGGAGGGACCTCGCATCTTTTACACATTTGTATGAAGAAAGGGATTCGTTCA 4507 D genome AAGGGGAAAGGAGGGGCCTAGCATCTTTTACACATTTGTATGAAGAAAGGGATTCGTTCA 4507 E genome AAGGGGGAAGGAGGGGCCTAGCATCTTTTACACATTTGTATGAAGAAAGGGATTCGTTCA 4469 G genome AAGGGGGAAGGAGGGGCCTAGCATCTTTTACACATTTGTATGAAGAAAGGGATTCGTTCA 4521 G genome GGGGGAAGGAGGGGCCTCGCATCTTTTACACATTTGTATGAAGAAAGGGATTCGTTCA 4444 Gossyp kirkii AAGGGGGAAGGAGGGGCCTAGCATCTTTTACACATTTGTATGAAGAAAGGGATTCGTTCA 4617 Kokia drynar AAGGGGGAAGGAGGGGCCTAGCATCTTTTACACATTTGTATGAAGAAAGGGATTCGTTCA 4382 4870 4880 4890 4900 4910 4920 A genome GACCATCGGTAGAGTTTGTAAGACCACGACTGATCCTGAAAGGAGGGGATGGAAAAAAGA 4555 B genome GACCATCGGTAGAGTTTGTAAGACCACGACTGATCCTGAAAGGAGTGGATGGAAAAAAGA 4550 C genome GACCATCGGTAGAGTTTGTAAGACCACGACTGATCCTGAAAGGAGTGGATGGAAAAAAGA 4567 D genome GACCATCGGTAGAGTTTGTAAGACCACGACTGATCCTGAAAGGAGTGGATGGAAAAAAGA 4567 E genome GACCATCGGTAGAGTTTGTAAGACCACGACTGATCCTGAAAGGAGTGGATGGAAAAAAGA 4529 G genome GACCATCGGTAGAGTTTGTAAGACCACGACTGATCCTGAAAGGAGGGGATGGAAAAAAGA 4581 G genome GACCATCGGTAGAGTTTGTAAGACCACGACTGATCCTGAAAGGAGTGGATGGAAAAAAGA 4504 Gossyp kirkii GACCATCGGTAGAGTTTGTAAGACCACGACTGATCCTGAAAGGAGTGGATGGAAAAAAGA 4677 Kokia drynar GACCATCGGTAGAGTTTGTAAGACCACGACTGATCCTGAAAGGAGTGGATGGAAAAAAGA 4442 4930 4940 4950 4960 4970 4980 A genome GCATGTCGTAGCAATGGAGAATTCTAAGAATCCTTTTTTTCCGGATCATTCC 4607 B genome GCATGTCGTAGCAATGGAGAATTCTAAGAATCCTTTTTTTCCGGATCATTCCCAAAAAAA 4610 C genome GCATGTCGTAGCAATGGAGAATTCTAAGAATCCTTTTTTTCCGGATCATTCCAAAAAAAA 4627 D genome GCATGTCGTAGCAATGGAGAATTCTAAGAATCCTTTTTTTCCGGATCATTCCAAAAAAAA 4627 E genome GCATGTCGTAGCAATGGAGAATTCTAAGAATCCTTTTTTTCCGGATCATTCCAAAAAAA 4588 G genome GCATGTCGTAGCAATGGAGAATTCTAAGAATCCTTTTTTTCCGGATCATTCCAAAAAAAA 4641 G genome GCATGTCGTAGCAATGGAGAATTCTAAGAATCCTTTTTT CCGGATCATTCCAAAAAAAA 4563 Gossyp kirkii GCATGTCGTATCAATGGAGAATTCTAAGAATCCTTTTTT CCGGATCATTCCAAAAAAA 4735 Kokia drynar GCATGTCGTATCAATGGAGAATTCTAAGAATCCTTTTTT CCGGATCATTCCAAAAAAA 4500 4990 5000 5010 5020 5030 5040 A genome CGTTTTTGAATTTTTGGTGCGGAACAAAAAAAATGAATTGAATTCAAAGTTGGGTCGAG 4666 B genome CCGTTTTTGAATTTTTGGTGCGGAACAAAAAAAATGAATTGAATTCAAAGTTGGGTCGAG 4670 C genome CCGTTTTTGAATTTTTGGTGCGGAACAAAAAAAATTAATTGAATTCAAAGTTGGGTCGAG 4687 D genome CCGTTTTTGAATTTTTGGTGCGGAACAAAAAAAATGAATTGAATTCAAAGTTGGGTCGAG 4687 E genome CCGTTTTTGAATTTTTGGTGCGGAACAAAAAAA TGAATTGAATTCAAAGTTGGGTCGAG 4647 G genome CCGTTTTTGAATTTTTGGTGCGGAACAAAAAAAATGAATTGAATTCAAAGTTGGGTCGAG 4701 G genome CCGTTTTTGAATTTTTGGTGCGGAACAAAAAAAATTAATTGAATTCAAAGTTGGGTCGAG 4623 Gossyp kirkii CCGTTTTTGAATTTTTGGTGCGGAACAAAAAAAATGAATTGAATTCAAAGTTGGGTCGAG 4795 Kokia drynar CCGTTTTTGAATTTTTGGTGCGGAACAAAAAAAATGAATTGAATTCAAAGTTGGGTCGAG 4560 5050 5060 5070 5080 5090 5100 A genome TGAATAAATGGATAGAGCTCTACGGCCCCAATTATAGGGAAACAAAAAGGAACGAGCTTC 4726 B genome TGAATAAATGGATAGAGCTCTACGGCCCCAATTATAGGGAAACAAAAAGTAACGAGCTTC 4730 C genome TGAATAAATGGATAGAGCTCTACGGCCCCAATTATAGGGAAACAAAAAGTAACGAGCTTC 4747 D genome TGAATAAATGGATAGAGCTCTACGGCCCCAATTATAGGGAAACAAAAAGTAACGAGCTTC 4747 E genome TGAATAAATGGATAGAGCTCTACGGCCCCAATTATAGGGAAACAAAAAGGAACGAGCTTC 4707 G genome TGAATAAATGGATAGAGCTCTACGGCCCCAATTATAGGGAAACAAAAAGGAACGAGCTTC 4761 G genome TGAATAAATGGATAGAGCTCTACGGCCCCAATTATAGGGAAACAAAAAGTAACGAGCTTC 4683 Gossyp kirkii TGAATAAATGGATAGAGCTCTACGGCCCCAATTAGAGGGAAACAAAAAGTAACGAGCTTC 4855 Kokia drynar TGAATAAATGGATAGAGCGCTACGGCCCCAATTAGAGGGAAACAAAAAGTAACGAGCTTC 4620 5110 5120 5130 5140 5150 5160 A genome TGTTCTCAATTTGAATGATTACCTGATCTAATTAAACGTTAAAAATAAATTAGTGCCTAA 4786 B genome TGTTCTCAATTTGAATGATTACCTGATCTAATTAAACGTTAAAAATAAATTAGTGCCTAA 4790 C genome TGTTCTCAATTTGAATGATTACCTGATCTAATTAAACGTTAAAAATAAATTAGTGCCTAG 4807 D genome TGTTCTCAATTTGAATGATTACCTGATCTAATTAAACGTTAAAAAGAAATTAGTGCCTAA 4807 E genome TGTTCTCAATTTGAATGATTACCTGATCTAATTAAACGTTAAAAAGAAATTAGTGCCTAA 4767 G genome TGTTCTCAATTTGAATGATTACCTGATCTAATTAAACGTTAAAAATAAATTAGTGCCTAA 4821 G genome TGTTCTCAATTTGAATGATTACCTGATCTAATTAAACGTTAAAAATAAATTAGTGCCTAG 4743 Gossyp kirkii TGTTCTCAATTTGAATGATTACCTGATCTAATTAAACGTTAAAAATAAATTAGTGCCTAA 4915 Kokia drynar TGTTCTCAATTTGAATGATTACCCGATCTAATTAAACGTTAAAAATAAATTAGTGCCTAA 4680 5170 5180 5190 5200 5210 5220 A genome TGTGGTAAAGGTTTTTCTCATGAGTAAATTATCGATTTTTTTATGAGTCCTAA T 4840 B genome TGTGGTAAAGGTTTTTCTCATGAGTAAATTATCGATTTTTTTATGAGTCCTAA T 4844 C genome TGTGGTAAAGGTTTTTCTCATGAGTAAATTATCGATTTTTTTATGAGTCCTAATTATTAT 4867 D genome TGGGGTAAAGGTTTTTCTCATGAGTAAATTATCGATTTTTTTATGAGTCC TTAT 4861 E genome TGTGGTAAAGGTTTTTCTCATGAGTAAATTATCGATTTTTTTATGAGTCCTAA T 4821 G genome TGTGGTAAAGGTTTTTCTCATGAGTAAATTATCGATTTTTTTATGAGTCCTAATTATTAT 4881 G genome TGTGGTAAAGGTTTTTCTCATGAGTAAATTATCGATTTTTTTATGAGTCCTAA TTAT 4800 Gossyp kirkii TGTGGTAAAGGTTTTTCTCATGAGTAAATTATCGATTTTTTTATGAGTCCTAATTATTAT 4975 Kokia drynar TGGGGTAAAGGTTTTTCTCATGAGTAAATTATCGATTTTTTTATGAGTCCTAATTATTAT 4740 5230 5240 5250 5260 5270 5280 A genome TATTAGGCATTCCCTTTATGGGTTAGCCATGAATGTGTAGAAGAAGCAGTATATTGATAA 4900 B genome TATTAGGCATTCCCTTTATGGGTTAGCCATGAATGTGTAGAAGAAGCAGTATATTGATAA 4904 C genome TATTAGGCATTCCCTTTATGGGTTAGCCATGAATGTGTAGAAGAAGCAGTATATTGATAA 4927 D genome TATTAGGCATTCCCTTTATGGGTTAGCCATGAATGTGTAGAAGAAGCAGTATATTGATAA 4921 E genome TATTAGGCATTCCCTTTATGGGTTAGCCATGAATGTGTAGAAGAAGCAGTATATTGATAA 4881 G genome TATTAGGCATTCCCTTTATGGGTTAGCCATGAATGTGTAGAAGAAGCAGTATATTGATAA 4941 G genome TATTAGGCATTCCCTTTATGGGTTAGCCATGAATGTGTAGAAGAAGCAGTATATTGATAA 4860 Gossyp kirkii TATTAGGCATTCCCTTTATGGGTTAGCCATGAATGTGTAGAAGAAGCAGTATATTGATAA 5035 Kokia drynar TATTAGGCATTCCCTTTATGGGTTAGCCATGAATGTGTAGAAGAAGCAGTATATTGATAA 4800 5290 5300 5310 5320 5330 5340 A genome AGAAAAGATATTTTTTT CCAAAATCAAAAGAGCGATTGGGTTGAAAAAATAAAGGATTT 4959 B genome AGAAAAGATATTTTTTT CCAAAATCAAAAGAGCGATTGGGTTGAAAAAATAAAGGATTT 4963 C genome AGAAAAGATATTTTTTT CCAAAATCAAAAGAGCGATTGGGTTGAAAAAATAAAGGATTT 4986 D genome AGAAAAGATATTTTTTT CCAAAATCAAAAGAGCGATTGGGTTGAAAAAATAAAGGATTT 4980 E genome AGAAAAGATATTTTTTT CCAAAATCAAAAGAGCGATTGGGTTGAAAAAATAAAGGATTT 4940 G genome AGAAAAGATATTTTTTT CCAAAATCAAAAGAGCGATTGGGTTGAAAAAATAAAGGATTT 5000 G genome AGAAAAGATATTTTTTTTCCAAAATCAAAAGAGCGATTGGGTTGAAAAAATAAAGGATTT 4920 Gossyp kirkii AGAAAAGATATTTTTTT CCAAAATCAAAAGAGCGATTGGGTTGAAAAAATAAAGGATTT 5094 Kokia drynar AGAAAAGATATTTTTTT CCAAAATCAAAAGAGCGATTGGGTTGAAAAAATAAAGGATTT 4859 5350 5360 5370 5380 5390 5400 A genome CTAACCGTCTTCTTATCCTATAACGAACATAAATCAATTAGATGGCAAAAGA TAG 5014 B genome CTAACCGTCTTCTTATCCTATAACGAACATAACTCAATTAGATGGCAAAAGA TAG 5018 C genome CTAACCGTCTTCTTATCCTATAACGAACATAACTCAATTAGATGGCAAAAGA TAG 5041 D genome CTAACCGTCTTCTTATCCTATAACGAACATAAATAAATTAGATGGCAAAAGAAAAGATAG 5040 E genome CTAACCGTCTTCTTATCCTATAACGAACATAAATCAATTCGATGGCAAAAGA TAG 4995 G genome CTAACCGTCTTCTTATCCTATAACGAACATAAATCAATTAGATGGCAAAAGA TAG 5055 G genome CTAACCGTCTTCTTATCCTATAACGAACATAACTCAATTAGATGGCAAAAGA TAG 4975 Gossyp kirkii CTAACCGTCTTCTTATCCTATAACGAATATAAATCAATTAGATGGCAAAAGA TAG 5149 Kokia drynar CTAACCATCTTCTTATCCTATAACGAATATAAATCAATTAGATGGCAAAAGA TAG 4914 5410 5420 5430 5440 5450 5460 A genome GATAGAGAATCCGTTGATGAATCCGCCTGTCTCCGAGGTATCTATTCTTTTCTTACTATA 5074 B genome GATAGAGAATCCGTTGATGAATCCGCCTGTCTCCGAGG ATCTATTCTTTTCTTACTATA 5078 C genome GATAGAGAATCCGTTGATGAATCCGCCTGTCTCCGAGGTATCTATTCTTTTCTTACTATA 5101 D genome GATAGAGAATCCGTTGATGAATCCGCCTGTCTCCGAGGTATCTATTCTTTTCTTACTATA 5100 E genome GATAGAGAATCCGTTGATGAATCCGCCTGTCTCCGAGGTATCTATTCTTTTCTTACTATA 5055 G genome GATAGAGAATCCGTTGATGAATCCGCCTGTCTCCGAGGTATCTATTCTTTTCTTACTATA 5115 G genome GATAGAGAATCCGTTGATGAATCCGCCTGTCTCCGAGGTATCTATTCTTTTCTTACTATA 5035 Gossyp kirkii GATAGAGAATCCGTTGATGAATCCGCCTGTCTCCGAGGTATCTATTCTTTTCTTACTATA 5209 Kokia drynar GATAGAGAATCCGTTGATGAATCCGCCTGTCTCCGAGGTATCTATTCTTTTCTTACTATA 4974 5470 5480 5490 5500 5510 5520 A genome ATACCTTGTTTTGACTGTATCGCACTATGTATCATTTAATAACCGAATAGATCCCCTATC 5134 B genome ATACCTTGTTTTGACTGTATCGCACTATGTATCATTTAATAACCGAATAGATCCCCTATC 5138 C genome ATACCTTGTTTTGACTGTATCGCACTATGTATCATTTAATAACCTAATAGATCCCCTATC 5161 D genome ATACCTTGTTTTGACTGTATCGCACTATGTATCATTTAATAACCGAATAGATCCCCTATC 5160 E genome ATACCTTGTTTTGACTGTATCGCACTATGTATCATTTAATAACCGAATAGATCCCCTATC 5115 G genome ATACCTTGTTTTGACTGTATCGCACTATGTATCATTTAATAACCGAATAGATCCCCTATC 5175 G genome ATACCTTGTTTTGACTGTATCGCACTATGTATCATTTAATAACCTAATAGATCCCCTATC 5095 Gossyp kirkii ATACCTTGTTTTGACTGTATCGCACTATGTATCATTTAATAACCGAATAGATCCCCTATC 5269 Kokia drynar ATACCTTGTTTTGACTGTATCGCACTATGTATCATTTAATAACCGAATAGATCCCCTATC 5034 5530 5540 5550 5560 5570 5580 A genome TTTGGTTCAAATCGAATTTGAAATGGAGGAATTTCAAGTATATTTAGAACTAAATAGATC 5194 B genome TTTGGGTCAAATCGAATTTGAAATGGAGGAATTTCAAGTATATTTAGAACTAAATAGATC 5198 C genome TTTGGGTCAAATCGAATTTGAAATGGAGGAATTTCAAGTCTATTTAGAACTAAATAGATC 5221 D genome TTTGGTTCAAATCGAATTTGAAATGGAGGAATTTCAAGTATATTTAGAACTAAATAGATC 5220 E genome TTTGGTTCAAATCGAATTTGAAATGGAGGAATTTCAAGTATATTTAGAACTAAATAGATC 5175 G genome TTTGGTTCAAATCGAATTTGAAATGGAGGAATTTCAAGTATATTTAGAACTAAATAGATC 5235 G genome TTTGGGTCAAATCGAATTTGAAATGGAGGAATTTCAAGTCTATTTAGAACTAAATAGATC 5155 Gossyp kirkii TTTGGTTCAAATCGAATTTGAAATGGAGGAATTTCAAGTATATTTAGAACTAAATAGATC 5329 Kokia drynar TTTGGTTCCAATCGAATTTGAAATGGAGCAATTTCAAGTATATTTAGAACTAAATAGATC 5094 5590 5600 5610 5620 5630 5640 A genome CCGCCGACACGATTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGCACTTGCTCA 5254 B genome CCGCCGACACGATTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGCACTTGCTCA 5258 C genome CCGCCGACACGATTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGCACTTGCTCA 5281 D genome CCGCCGACACGATTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGCACTTGCTCA 5280 E genome CCGCCGACACGATTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGCACTTGCTCA 5235 G genome CCGCCGACACGATTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGCACTTGCTCA 5295 G genome CCGCCGACACGATTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGCACTTGCTCA 5215 Gossyp kirkii CCGCCGACACGATTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTTGCTCA 5389 Kokia drynar CCGCCGACACGATTTCCTATACCCACTTATTTTTCGGGAGTCTATTTATGCACTTGCTCA 5154 5650 5660 5670 5680 5690 5700 A genome TGAGCATGGTTTAAATAAATCGATGATTTTTTTTGAAAATCAGGGTTATGGTAATAAATT 5314 B genome TGAGCATGGTTTAAATAAATCGATGATTTTTTTTGAAAATCAGGGTTATGGTAATAAATT 5318 C genome TGAGCATGGTTTAAATAAATCGATGATTTTTTTTGAAAATCAGGGTTATGGTAATAAATT 5341

    Original URL path: http://ajbsupp.botany.org/v89/cronn-chl.txt (2016-02-14)
    Open archived version from archive


  • GTGGAAAGTT GGAAAGAAAA GAAGAATAAG AAAAAAAAGA CTTCGATCAA GGTGGAAATA GAGGCTCAAG 3495 C genome GTGGAAAGTT GGAAAGAAAA GAAGAATAAG AAAAAAAAGA CTTCGATCAA GGTGGAAATA GAGGATCAAG 3442 D genome GTGGAAAGTT GGAAAGAAAA GAAGAATAAG AAAAAAAAGA CTTCGATCAA GGTGGAAATA GAGGCTCAAG 3440 E genome GTGGAAAGTT GGAAAGAAAA GAAGAATAAG AAAAAAAAGA CTTCGATCGA GGTGGAAATA AAGGCTCAAG 3487 F genome GTGGAAAGTT GGAAAGAAAA GAAGAATAAG AAAAAAAAGA CTTCGATCAA GGTGGAAATA GAGGCTCAAG 3495 G genome GTGGAAAGTT GGAAAGAAA A TATT AATAATAAGA CTTCAATCAA GGTGGAAATA GAGGCTCAAG 3487 Gossyp kirkii GTGGAAAGTT GGAAAGAAAA GAAGAATAAG AAGAAAAAGA CTTCGATCAA GGTGGAAATA GAGGCTCAAG 3437 Kokia drynar GTGGAGAGTT GGAAAGAAAA GAAGAATAAG AAGAAAAAGA CTTCGATCAA GGTGGAAATA GAGGCTCAAG 3433 3510 3520 3530 3540 3550 3560 3570 A genome TTCCGCCTGA GCAACTCATG GAAGATAAAC CGTAAGTTTC AATTACAAAG TCTTACCTGA ACCCTGTTGT 3513 B genome TTCCGCCTGA GCAACTCATG GAAGATAAAC CGTAAGTTTC AATTACAAAG CCTTACCTGA ACTCTGTTGT 3565 C genome TTCCGCCTGA GCAACTCATG GAAGATAAAC CGTAAGTTTC AATTACAAAG CCTTACCTGA ACTCTGTTGT 3512 D genome TTCCGCCTGA GCAACTCATG GAAGATAAAC CGTAAGTTTC AATTACAAAG CCTTCCCTGA ACTCTGTTGT 3510 E genome TTCCGCCTGG GCAACTCATG GAAGATAAAC CGTAAGTTTC AATTACAAAG CCTTACCTGA ACTCTGCTGT 3557 F genome TTCCGCCAGA GCAACTCATG GAAGATAAAC CGTAAGTTTC AATTACAAAG CCTTACCTGA ACTCTGTTGT 3565 G genome TTCCGCATGA GCAAATCATG GAAGATAAAC CGTAAGTTTC AATTACAAAG CCTTACCTGA ACTCTGTTGT 3557 Gossyp kirkii TTCCGCCTGA GCAACTCATG GAAGATAAAC TGTAAGTTTC AATTACAAAG CCTTACCTGA ACTCCGTTGT 3507 Kokia drynar TTCCGGCTGA GCAACTCATG GAAGATAAAC CGTAAGTTTC AATTACAAAG CCTTACCTGA ACTCTGTTGT 3503 3580 3590 3600 3610 3620 3630 3640 A genome TTATTTATAA TACAAAGCAA ATTAATGAGA AGAGGTCAGT AATGTTTTTG TTTATAACAT TTTGACCAAC 3583 B genome TTATTTATAA TACAAAGCAA ATTAATGAGA AGAAGTCAGT AATGTTTTTG TTTATAACAT TTTGACCAAC 3635 C genome TTAT AA TACAAAGCAA ATTAATGAGA AGAAGTCAGT AATGTTTTTG TTTATAACAT TTTGACCAAC 3578 D genome TTAT AA TACAAAGCAA ATTAATGAGA AGAAGTCATT AATGTTTTTG TTTATAACAT TTTGACCAAC 3576 E genome TTAT AA TACAAAGCAA ATTAATGAGA AGAAGTCAGT AATGTTTTTG TTTATAACAT TTTGACCAAC 3623 F genome TTATTTATAA TACAAAGCAA ATTAATGAGA AGAAGTCAGT AATGTTTTTG TTTTTAACAT TT GACCAAC 3634 G genome TTAT AA TACAAAGCAA ATTAATGAGA AGAAGTCAGT AATGATTTTG TTTATAACAT TTTGACCAAC 3623 Gossyp kirkii TTAT ATAA TACAAAGCAA ATTA TGAGA AGAAGTCAGT AATGTTTTTG TTTATAACAT TTTGACCAAC 3574 Kokia drynar TTAT ATAA TACAAAGCAA ATTA TGAGA AGAAGTCAGT AATGTTTTTG TTTATAACAA TTTGACCAAC 3570 3650 3660 3670 3680 3690 3700 3710 A genome CACTAATAGC TTTATTGAGC ATGCTTTAAC CATATATATC AGATTACCAA TTTGATTTGC TTAGAATTTA 3653 B genome CACTAATAGC TTTATTGAGC ATGCTTTAAC CATATATATC AGATTACCAA TTTGATTTGC TTAGAATTTA 3705 C genome CACTAATAGC TTTATTGAGC ATGCTTTAAC CATATATATC AGATTACCAA TTTGATTTGC TTAGAATTTA 3648 D genome CACTAATCGC TTTATTGAGC ATGCTTTAAC CATATATATC AGATTACCAA TTTGATTTGC TTAGAATTTA 3646 E genome CACTAATAGC TTTATTGAGC ATGCTTTAAC CATATATATC AGATTACCAA TTTGATTTGC TTAGAATTTA 3693 F genome CACTAATAGC TTTATTGAGC ATGCTTTAAC CATATATATC AGATTACCAA TTTGATTTGC TTAGAATTTA 3704 G genome CATTAATAGC TTTATTGAGC ATGCTTTAAC CATATATATC AGATTACCAA TTTGATTTGC TTAGAATTTA 3693 Gossyp kirkii CACTAATAGC TTTATTGAGC ACGCTTTAAC CATATATATC AGATTACCAA TTTAATTTGC TTAGAATTTA 3644 Kokia drynar CACTAATAGC TTTATTGAGC ACGCTTTACC CATATATATC AGATTACCAA TTTGATTTGC TTAGAATTTA 3640 3720 3730 3740 3750 3760 3770 3780 A genome ATGGAAGTAA TGTTCAATTA TGACTGATAT GTAATATTTG CTCTTGCAGA GCAGCTGATG CCTTTCAACC 3723 B genome ATGGAAGTAA TGTTCAATTA TGACTGATAT GTAATATTTG CTCTTGCAGA GCAGCTGATG CATTTCAACC 3775 C genome ATGGAAGTAA TGTTCAATTA TGACTGATAT GTAATATTTG CTTTTGCAGA GCAGCTGATG CTTTTCAACC 3718 D genome ATGGAAGTAA TGTTCAATTA TGACTGATAT GTAATATTTG CTTTTGCAGA GCAGCTGATG CTTTTCAACC 3716 E genome ATGAAAGTAA TGTTCAATTA TGACTGATAT GTAATATTTG CTTTTGCAGA GCAGCTGATA CTTTTCAATC 3763 F genome ATGGAAGTAA TGTTCAATTA TGACTGATAT GTAATATTTG CTCTTGCAGA GCAGCTGATG CTTTTCAACC 3774 G genome ATGGAAGTAA TGTTCAATTA TGACTGAAAT GTAATATTTG CTTTTGCAGA GCAGCTGATG CTTTTCAACC 3763 Gossyp kirkii ATGGAAGTAA TGTTCAATTA TGACTGATAT GATATATTTG CTTTTGCAGA GCAGCTGATG CTTTTCAACC 3714 Kokia drynar ATGGAAGTAA TGTTCAATTA TGACTGATAT GATATATTTG CTTTTGCAGA GCAGCTGATG CTTTTCAACC 3710 3790 3800 3810 3820 3830 3840 3850 A genome CCTCTCGACC GTAATTCCAA TTTCGAAAAG TAGACTTGCA CTATATAGAA CTGTGATCAT TATGCGGTTG 3793 B genome CCTCTCGACC GTAATTCCAA TTCCGAAAAG CAGACTTGCA CCATATAGAA CTGTGATCAT TATGCGTTTG 3845 C genome CCTCTCGACC GTAATTCCAA TTCCGAAAAG CAAACTTGCA CCATATAGAA CTGTGATCAT TATGCGGTTG 3788 D genome CCTCTCGACC GTAATTCCAA TTCCGAAAAG CAGACTTGCA CCATATAGAA CTGTGATCAT TATGCGGTTG 3786 E genome CCTCTCGACC GTAGTTCCAA TTCCGAAAAG CAGACTTGCA CCATATAGAA CTGTGATCAT TATGCGGTTG 3833 F genome CCTCTCGACC GTAATTCCAA TTCCGAAAAG CAGACTTGCA CCATATAGAA CTGTGATCAT TATGCGGTTG 3844 G genome CCTCTCGACC GTAATTCCAA TTCCGAAAAG CAAACTTGCA CCATATAGAA CTGTGATCAT TATGCGGTTG 3833 Gossyp kirkii CCTCTCGACC GTAATTCCAA TTCCGAAAAG CAGACTTGCA CCATATAGAA CTGTGATCAT TATGCGGTTG 3784 Kokia drynar CCTCTCGACC GTAATTCCAA TTCCGAAAAG CAGACTTGCA CCATATAGAA CTGTGATCAT TATGCGGTTG 3780 3860 3870 3880 3890 3900 3910 3920 A genome ATCATTTTGG GTCTTTTCTT CCATTACCGA GTAACGAATC CAGTTGACAG TGCTTTTGCA CTGTGGCTGA 3863 B genome ATCATTTTGG GTCTTTTCTT CCATTACCGA GTAACGAATC CAGTTGACAG TGCTTTTGCT CTGTGGCTGA 3915 C genome ATCATTTTGG GTTTTTTCTT CCATTACCGA GTAACGAATC CAGTTGACAG TGCTTTTGCT CTGTGGCTGA 3858 D genome ATCATTTTGG GTCTTTTCTT CCATTACCGA GTAACGAATC CAGTTGACAG TGCTTTTGCT CTGTGGCTGA 3856 E genome ATCATTTTGG GTCTTTTCTT CCGTTACCGA GTAACGAATC CAGTTAACAG TGCTTTTGCT CTGTGGCTGA 3903 F genome ATCATTTTGG GTCTTTTCTT CCATTACCGA GTAACAAATC CAGTTGACAG TGCTTTTGCT CTGTGGCTGA 3914 G genome ATCATTTTGG GTTTTTTCTT CCATTACCGA GTAACGAATC CAGTTGACAG TGCCTTTGCT CTGTGGCTGA 3903 Gossyp kirkii ATCATTTTGG GTCTTTTCTT CCATTACCGA GTAACGAATC CAGTTGCCAG TGCTTTTGCT CTGTGGC 3854 Kokia drynar ATCATTTTGG GTCTTTTCTT CCATTACCGA GTAACGAATC CAGTTGACAG TGCTTTTGCT CTGTGGCG 3850 3930 3940 3950 3960 3970 3980 3990 A genome CTGTGGTTGA ACATGTTGGG TTGAATGTTA ATGGTGAACC CTTTGTGGCT TGCCATGAAT GTAATTTCCC 3933 B genome CTGTGGT GA ACATGTTGGG TTGAATGTTA ATGGTGAACC CTTTGTGGCT TGCCATGAAT GTAATTTCCC 3985 C genome CTGTGGTTGA ACATGTTGGG TTGAATGTTA ATGGTGAACC CTTTGTGGCT TGCCATGAAT GTAATTTCCC 3928 D genome CTGTGGTTGA ACATGTTGGG TTGAATGTTA ATGGTGAACC TTTTGTGGCT TGCCATGAAT GTAATTTCCC 3926 E genome CTGTGGT GA ACATGTTGGG TTGAATGTTA ATGGTGAACC CTTTGTGGCT TGCCATGAAT GTAATTTCCC 3973 F genome CTGTGGTTGA ACATGTCGGG TTGAATGTTA ATGGAGAACC CTTTGTGGCT TGCCATGAAT GTAATTTCCC 3984 G genome CTG GGTAGA ACATGTTGGG TT AATGTCA ATGGTGAACC CT G GGCT TGCCATGAAT GT TTTCCC 3973 Gossyp kirkii GA ACATGTTGGG TTGAATGTTA ATGGTGAACC CTTTGTGGCT TGCCATGAAT GTAATTTCCC 3924 Kokia drynar TGTTGGG TTGAATGTTA ATGGTGAACC CTTTGTGGCT TGCCATGAAT GTAATCTCCC 3920 4000 4010 4020 4030 4040 4050 4060 A genome TATTTGTAAG AGTTGTTTTG AGTATGATCT TAAGGAAGGA CGAAAAGCTT GCTTGCGTTG TGGTAGTCCG 4003 B genome TATTTGTAAG AGTTGTTTTG AGTATGATCT TAAGGAAGGA CGAAAAGCTT GCTTGCGTTG TGGTA TCCA 4055 C genome TATTTGTAAG AGTTGTTTTG AGTATGATCT TAAGGAAGGA CGAAAAGCTT GCTTGCGTTG TGGTAGTCCA 3998 D genome TATTTGTAAG AGCTGTTTTG AGTATGATCT TAAGGAAGGA CGAAAAGCTT GCTTGCGTTG TGGTAGTCCA 3996 E genome TATTTGTAAG AGTTGTTTTG AGTATGATCT TAAGGAAGGA CGAAAAGCTT GCTTACGTTG TGGTAGTCCA 4043 F genome TATTTGTAAG AGTTGTTTTG AGTATGATCT TAAGGAAGGA CGAAAAGCTT GTTTGCGTTG TGGTAATCCA 4054 G genome TATTTGTAAG AGTTGTTTTG AGTATAATCT TAAGGAAGGA CGAAAAGCTT GCTTGCGTTG TGGTAGTCCA 4043 Gossyp kirkii TATTTGTAAG AGTTGTTTTG AGTATGATCT TAAGGAAGGA CGAAAAGCTT GCTTGCGTTG TGGTACCCCA 3994 Kokia drynar TATTTGTAAG AGTTGTTTTG AGTATGATCT TAAGGAAGGA CGAAAAGCTT GCTTGCGTTG TGGTAGCACA 3990 4070 4080 4090 4100 4110 4120 4130 A genome TATGATGGTA CATTTCATTT TAATTCTTGA TGCTAGTTTT TTACTTGTTT CCATTTGGTT CTTGATAAAT 4073 B genome TATGATGGTA CATTTCATTT TAACTCTTGA TACTAGTTTT TTACTTGTTT CCATTTGGTT CTTGATAAAT 4125 C genome TATGATGGTA CATTTCATTT TAATTCTTGA TGCTAGTTTT TTACTTGTTT CCATCTGGTT CTTGATAAAT 4068 D genome TATGATGGTA CATTTCATTT TAATTTTTGA TGCTAGTTTT TTACTTGTTC CCATTTGGTT CTTGATAAAT 4066 E genome TATGATGGTA CATTTCATTT TAATTCTTGA TGCTAGTTTT TTACTTGTTT CCATTTGGTT CTTGATAAAT 4113 F genome TATGATGGTA CATTTCATTT TAATTCTTGA TGCTAGTTTT TTACTTGTTT TCATTAGGTT CTTGATAAAT 4124 G genome TATGATGGTA CATTTCATTT TAATTCTTGA TGCTAGTTTT TTACTTGTTT CCATTTGGTT CTTGATAAAT 4113 Gossyp kirkii TATGATGGTA CATTTCATTT TAATTCTTGA TGCTAGTTTT TTACTTGTTT CCATTTGGTT CTTGATAAAT 4064 Kokia drynar TATGATGGTA CATTTCATTT TAATTCTTGA TGCTAGTTTT TTACTTGTTT CCATTTGGTT CTTGATAAAT 4060 4140 4150 4160 4170 4180 4190 4200 A genome CTTTGTTATA A TCTTGTGT TTGCCAAGTG CTTGTTTGAT TTCCCATGAA AAAGATAAAG ATAGAGAAGT 4142 B genome CTTTGTTATA AATCTTGTGT TTGCCAAGTG CTTGTTTGAT TTCCCATGAA AAAGATAAAG ATAGAGAAGT 4195 C genome CTTTGTTATA AATCTTGTGT TTGCCAAGTG CTTGTTTGAT TTCCCATGAA AAAGATAAAG ATAGAGAAGT 4138 D genome CTTTGTTATA AATCTTGTGA TTGCCAAGTG CTTGCTTGAT TTCCCATGAA AAAGATAAAG ATAGAGAAGT 4136 E genome CTTTGTTATA AATCTTGTGT TTGCCAAATG CTTGTTTGAT TTCCCATGAA AAAGATAAAG ATAGAGAAGT 4183 F genome CTTTGTTATA AATCTTGTGT TTGTCAAGTG CTTGTTTGAT TTCCCATGAA AAAGATAGAG ATAGAGAAGT 4194 G genome CTTTGTTATA AATCTTGTGT TTGCCAAGTG CTTGTTCGAT TTCCCATGAA AATGATAAAT ATAGAGAAGT 4183 Gossyp kirkii CTTTGTTATA AATCTTGTAT TTGCCAAGTG CTTGTTTAAT TTCCCATGAA AAAGATAAAG ATAGAGAAGT 4134 Kokia drynar CTATGTTATA AATCTTGTAT TTGCCAAGTG CTTGTTTAAT TTCCCATGAA AAAGATAAAG ATAGAGAAGT 4130 4210 4220 4230 4240 4250 4260 4270 A genome TGTAAACTGA TTGCACGACT GATTATTGTG AACTCCTCAG AAAACCTGTT GGACGATGTC GAGAAGGCCA 4212 B genome TGTAAACTGA TTGCACGACT GATTATTGTG AACTCCTCA AAAACCTGTT GGACGATGTC GAAAAGGCCA 4265 C genome TGTAAACTGA TTGCACGACT GATTATTGTG AGCTCCTCAG AAAACCTGTT GGACGATGTC GAGAAGGCCA 4208 D genome TGTAAACTGA TTGCACGACT GATTATTGTG AACTCCTCAG AAAACCTGTT GGACGATGTC GAGAAGGCCA 4206 E genome TGTAAACTGA TTGCACGACT GATTATTGTG AATTCCTCAG AAAACCTGTT GGACGATGTC GAGAAGGCCA 4253 F genome TGTAAACTGA TTGCACGACT GATTATTGTG AACTCCTCAG AAAACCTATT GGACGATGTC GAGAAGGCCA 4264 G genome TGTAAACTGA TTGCACGACT GATTATTGTG AACTC AG AAAACCTGTT GGAC ATGTC GAGAAGGCCA 4250 Gossyp kirkii TTTAAACTGA TTGCACGACT GGTTATTGTG AACTCCTCAG AGAACCTGTT GGACGATGTC GAGAAGGCAA 4204 Kokia drynar TTTAAATTGA TTGCACGACT GGTTATTGTG AACTCCTCAG AGAACCTGTT GGACGATGTC GAGAAGGCAA 4200 4280 4290 4300 4310 4320 4330 4340 A genome CCGGCGATCA ATCGACAATG GCTGCACATT TGAGCAAGTC TCAGGTATTG TTTT TTGCT GCTTTTGAAA 4281 B genome CCGGCGATCA ATCGACAATG GCTGCACATT TGAGCAAGTC TCAGGTATTG TTTTCTTGCT GCCTTTGAAA 4335 C genome CCGGTGATCA ATCGACAATG GCTGCACATT TGAGCAAGTC TCAGGTACTG ATTT TTGCT GCCTTTGAAA 4277 D genome CCGGCGATCA ATCGACAATG GCTGCACATT TGAACAAGTC TCAGGTATTG TTTT TTGCT GCCTTTGAAA 4275 E genome CCGGGGATCA ATCGACAATG GCTGCACATT TGAGCAAGTC TCAGGTATTG TTTTTTTGCT GCCTTTGAAA 4323 F genome CCGGCGATCA ATCGACAATG GCTGCACATT TGAGCAAGTC TCAGGTATTG TTTT TTGCT GCCTTTGAAA 4333 G genome CCGGTGATCA ATCGACAATG GCTGCACATT TGACCAAGTC TCAGGTACTG TTTT TGCT GCCTTTGAAA 4318 Gossyp kirkii CAGGCGATCA ATCGACAATG GCTGCACAGT TGAGCAAGCC TCAGGTACTG TTTT TTGCT GCCTTTGAAA 4273 Kokia drynar CAGGCGATCA ATCGACAATG CCTGCACAGT TGAGCAAGTC TCAGGTACTG TTTT TTGCT GCCTTTGAAA 4269 4350 4360 4370 4380 4390 4400 4410 A genome GGTT CAGT CAAAGCCAGG AGGGATATTG AGAGCTTTGT GTTATTCATG TTGGTTTATA CAGGATGTTG 4349 B genome GGTT CAGT CAAAGCCAG AGGGATATTG AGAGCTTTGT GTTATTCATG TTGGTTTATA CAGGATGTTG 4402 C genome CGTT CAGT CAAAGCCAGG AGGGATATTG AGAGCTTTGT GTTATTCATG TTGGTTTATA CAGGATATTG 4345 D genome GGTT CAGT CAAAGCCAGG AGGGATATTG AGAGCTTTGT GTTATTCATG TTGGTTTATA CAGGATGTTG 4343 E genome GGTT CAGT CAAAGCCAGG AGGGATATTG AGAGCTTTGT GTTATTCATG TTGGTTTATA CAGGATGTTG 4391 F genome GGTT CAGT CAAAGCCAGG AGGGATATTG AGAGCTTTGT GTTATTCATG TTGGTTTATA CAGGATGTTG 4401 G genome ATTT CAGT CAAAGCCAGG AGGGATATTG AGAGCTTTGT GTTATTCATG TTGGTTTATA CAGGAT TTG 4386 Gossyp kirkii GGTTTTCAGT CAAAGCGAGG AGGGATATTG AAAGCTTTGT GTTTTTCATG TTGGTTTATA CAGGATGTTG 4343 Kokia drynar GGTTTTCAGT CAAAGCCGGG AGGGATATTG AAAGCTTTGT GTTATTCATG TTGGTTTATA CAGGATGTTG 4339 4420 4430 4440 4450 4460 4470 4480 A genome GAATTCATGC AAGACATATC AGCAGTGTGT CTACATTGGA TAGTGGTATG TAATATAAAT TTCTTTCCAT 4419 B genome GAATTCATGC AAGACATATC AGCAGTGTGT CTACATTGGA TAGTGGTATG TAATATAAAT TTCTTTCCAT 4472 C genome GAATTCATGC AAGACATATC AGCAGTGTGT CTACATTGGA TAGTGGTATG TAATATAAAT TTCTTTCCAT 4415 D genome GAATTCATGC AAGACATATC AGCAGTGTGT CTACATTGGA TAGTGGTATG TAATATAAAT TTCTTTCCAT 4413 E genome GAATTCATGC AAGACATATC AGCAGTGTGT CTACATTGGA TAGTGGTATG TAATAAAAAT TTCTTTCCAT 4461 F genome GAATTCATGC AAGACATATC AGCAGTGTGT CTACATTGGA TAGTGGTATG TAATATAAAT TTCTTTCCAT 4471 G genome GAATTCATGC AAGACATATC AGCAGTGTGT CTACATTGGA TAGTGGTATG TAATATAAAT TTCTTTCCAT 4456 Gossyp kirkii GAATTCATGC AAGACATATC AGCAGTGTGT CTACATTGGA TAGTGGTATG TAATATAAAT TTCTTTCCAT 44913 Kokia drynar GAATTCATGC AAGACATATC AGCAGTGTGT CTACATTGGA TAGTGGTATG TAATATAAAT TTCTTTCCAT 4409 4490 4500 4510 4520 4530 4540 4550 A genome ATTATTGGTT TCTTTCTTTC AA TTCCTT CAATTCTGAA AGCTCGAACC GTCTCGTAAA ATATCGTAGA 4487 B genome ACTATTGGTT TCTTTCTTTC AATCTTCCTT CAATTCTGAA AGCTCGAATC GTCTCGTAAA ATATCGTAGA 4542 C genome ATTATTGGTT TCTTTCTTTC AATCTTCCTT CAATTCTGAA AGCTCGAATC GTCTCGTAAA ATATCGTAGA 4485 D genome ATTAATGGTT TCTTTCTTTC AATCTTCCTT CAACTCTGAA AGCTCGAATC GTCTCGTAAA ATATCGTAGA 4483 E genome ATTATTGGTT TCTTTCTTTC AATCTTCCTT CAATTCTGAA ATATCGAATC GTCTCGTAAA ATATCGTAGA 4531 F genome ATTATTGGTT TCTTTCTTTC AATCTTCCTT CAATTCTGAA AGCTCGAATC GTCTCGTAAA ATATCGTAGA 4541 G genome ATTATTGGTT TCTTTCTTTC AATCTTCCTT CAATTCTGAA AGCTCGAATC GTCTCGTAAA ATATCGTAGA 4526 Gossyp kirkii ATTAATGATT TCTTTCTTTC AATCTTCCTT CAATTTTCAA CGCTCGAATT GTTTTGTAAA ATATCGTAGA 4483 Kokia drynar ATTATTGATT TCTTTCTTTC AATCTTCCTT CAATTCTCAA AGCTCGAATC GTCTTGTAAA ATATCGTAGA 4479 4560 4570 4580 4590 4600 4610 4620 A genome AATGACTGAA GACAATGGGA ATCCGATTTG GAAGAACAGG GTGGAAAGTT GGAAAGAAAA GAAGAACAAG 4557 B genome AATGACTGAA GACAATGGGA ATCCGATTTG GAAGAACAGG GTGGAAAGTT GGAAAGAAAA GAAGAACAAG 4612 C genome AATGACTGAA GACAATGGGA ATCCGATTTG GAAGAACAGG GTGGAAAGTT GGAAAGAAAA GAAGAACAAG 4555 D genome AATGGCTGAA GACAATGGGA ATTCGATTTG GAAGAACAGG GTGGAAAGTT GGAAAGAAAA GAAGAACAAG 4553 E genome AATGGCTGAA GACAATGGGA ATCCGATTTG GAAGAACAGG GTGGAAAGTT GGAAAGAAAA GAAGAACAAG 4601 F genome AATGACTGAA GACAATGGGA ATCCGATTTG GAAGAACAGG TGGAAAGTT GGAAAGAAAA GAAGAACAAG 4610 G genome AATGACTGAA GACAATGGGA ATCCGATTTG GAAGAACAGG GTGGAAAGTT GGAAAGAAAA GAAGAACAAG 4596 Gossyp kirkii AATGACTGAA G CAATGGGA ATCCGATTTG GAAGAACAGG GTGGAAAGTT GGAAAGAAAA GAAGA CAAG 4553 Kokia drynar AATGACTGAA GACAATGGGA ATCCGATTTG GAAGAACAGG GTGGAAAGTT GGAAAGAAAA GAAGAACAAG 4549 4630 4640 4650 4660 4670 4680 4690 A genome AAGAAGAAGC CTGCAACAAC TAAGGTTGAA AGAGAGGCTG AAATCCCACC TGAGCAACAA ATGGAAGATA 4627 B genome AAGAAGAAGC CTGCAACAAC CAAGGTTGAA AGAGAGGCTG AAATCCCACC TGAGCAACAA ATGGAAGATA 4682 C genome AAGAAGCAGC CTGCAACAAC TAAGGTTGAA AGAGAGGCTG AAATCCCACC TGAGCAACAA ATGGAAGATA 4625 D genome AAGAAGAAGC CTGCAACAAC TAAGGTTGAA AGAGAGGCTG AAATCCCACC TGAGCAACAA ATGGAAGATA 4623 E genome AAGAAGAAGC CTGCAACAAC CAAGATTGAA AGAGAGGCTG AAATCCCACC TGAGCAACAA ATGGACGATA 4671 F genome AAGAAGAAGC CTGCAGCAAA TAAGGTTGAA AGAGAGGCTG AAATCCCACC TGAGCAACAA ATGGAAGATA 4680 G genome AAGAAGAAGC CTGCAACAAC TAAGGTTGAA AGAGAGGCTG AAATCCCACC TGAGCAACAA ATGGAAGATA 4666 Gossyp kirkii AAGAAGAAGC CTGCAACAAC TAAGGTTGAA AGAGAGGCTG AAAT CCACC TGAGCAACAA ATGGAAGATA 4623 Kokia drynar AAGAAGAAGC CTGCCCCAAC TAAGGTTGAA AGAGAGGCTG AAATCCCACC TGAGCAACAA ATGGAAGATA 4619 4700 4710 4720 4730 4740 4750 4760 A genome AACCGTAAGT ATTTAATTAG AAAAGCCTTG CTTGATTTTG AAATATACAA AGC AGATTAATG 4689 B genome AACCGTAAGT ATTTAATTAG AAAAGCCTTG CTTGATTTTG AAGTATACAA AGC AGATTAATG 4744 C genome AACCGTAAGT ATTTAATTAG AAAAGCCTTG CTTGATTTTG AAATATACAA AGC AGATTAATG 4687 D genome AACCGTAAGT ATTTAATTAG AAAAGCCTTG CTTGATTTTG AAATGTACAA AGC AGATTAATG 4685 E genome AACCGTAAGT ATTTAATTAG AAAAGCCTTG CTTGATTTTG AAATCTACAA AGC AGATTAATG 4733 F genome AACCGTAAGT ATTTAATTAG AAAAGCCTTG CTTGATTTTG AAATATACAA AGC AGATTAATG 4742 G genome AACCGTAAGT ATTTAATTAG AAAAGCCTTG CTTGATTTTG AAATATACAA AGC AGATTAATG 4728 Gossyp kirkii AACCGTAAGT ATTTAATTAG AAAAGCCTTG CTTGATTTTG AAATATACAA AGCACTGAAG CAGATTAATG 4693 Kokia drynar AACCGTAAGT ATTTAATTAG AAAAGCGTTG CTTGATTTTG AAATATACAA AGCCCTGAAG CATATTAATG 4689 4770 4780 4790 4800 4810 4820 4830 A genome ATAAGAGCCT ATTTAGTAAA ATGATTTTTG TTTATGTTAT GTGTTACTGA TATGTAATAT TTGCATCTGC 4759 B genome ATAAGAGCCT ATTTAGTGAA ATGATTTTTG TTTATGTTAT GTGTTACTGA TATGTAATAT TTGCACCTGC 4814 C genome ATAAGAGCCT ATTTAGTGAA ATGATTTT G TTTATGTTAT GTGTT CTGA TATGTAATAT TTGCATCTGC 4756 D genome ATAAGAGCCT ATTTAGTGAA ATGATTTTTG TTTATGTTAT GTGTTACTGA TATGTAATAT TTGCATCTGC 4755 E genome ATAAGAGCCT ATTTAGTGAA ATGATTTTTG TTTATGTTAT GTGTTACTGA TATGTAATAT TTGCATCTGC 4803 F genome ATAAGAGCCT ATTTAGTGAA ATGATTTTTG TATGTGTTAT GTGTTACTGA TATGTAATAT TTGCATCTGC 4812 G genome ATAAGAGCCT ATTTAGTGAA ATGATTTTTG TTTATGTTCT GTGTTACTGA TATGTAATAT TTGCATCTGC 4798 Gossyp kirkii ATAAGGGT T ATTTAGTGAA ATGATTTTTG TTTATGTTGT GTGTTACTGA TATGTAATAT TTGCATCTGC 4763 Kokia drynar ATAAGGGTCT ATTTAGTGAA ATGATTTTTG TTTATGTTGT GTGTTACTGA TATGTAATAT TTGCATCTGC 4759 4840 4850 4860 4870 4880 4890 4900 A genome AGGGCACCGG ATGCTTCCCA GCCCCTCTCG ACTATAATTC CAATCCCGAA AAGCAGACTT GCACCATACC 4829 B genome AGGGCACCGG ATGCTTCCCA GCCCCTCTCG ACTATAATTC CAATCCCGAA AAGCAGACTT GCACCATACC 4884 C genome AGGGCACCGG ATGCTTCCCA GCCCCTCTCG ACTATAATTC CAATCCCGAA AAGCAGACTT GCACCATACC 4826 D genome AGGGCACCGG ATGCTTCCCA GCCCCTCTCG ACTATAATTC CAATCCCGAA AAGCAGACTT GCACCATACC 4825 E genome AGGGCACCGG ATGCTTCCCA GCCCCTCTCG ACTATAATTC CAATCCCGAA AAGCAGACTT GCACCATACC 4873 F genome AGGGCACCGG ATGCTTCCCA GCCCCTCTCG ACTATAATTC CAAT CCGAA AAGCAGACTT GCACCATACC 4882 G genome AGGGCACC 4868 Gossyp kirkii AGGGTACCGG ATGCTTCCCA GCCCCTCTCG ACTATAATTC CAATCCCGAA AAGCAGACTT GCACCATACC 4833 Kokia drynar AGGGTACCGG ATGCTTCCCA GCCCCTCTCG ACTATAATTC CAATCCCGAA AAGCAGACTT GCACCATACC 4829 4910 4920 4930 4940 4950 4960 4970 A genome GAACCGTGAT CATTATGCGA TTGATCATTC TCGGTCTTTT CTTCCATTAT CGAGTAACAA ACCCCGTTGA 4899 B genome GAACCGTGAT CATTATGCGA TTGATCATTC TCGGTCTTTT CTTCCATTAT CGAGTAACAA ACCCCGTTGA 4954 C genome GAACCGTGAT CATTATGCGA TTGATCATTC TCGGTCTTTT CTTCCATTAT CGAGTAACAA ACCCCGTTGA 4896 D genome GAACCGTGAT CATTATGCGA TTGATCATTC TTGGTCTTTT CTTCCATTAT CGAGTAACAA ACCCCGTTGA 4895 E genome GAACCGTAAT CATTATGCGA TTGATCATTC TCGGTCTTTT CTTCCATTAT CGAGTAACAA ACCCCGTTGA 4943 F genome GAACCGTGAT CATTATGCGA TTGATCATTC TCGGTCTTTT CTTCCATTAT CGAGTAACAA ACCCCGTTGA 4952 G genome TCGGTCTTTT CTTCCATTAT CGAGTAACAA ACCCCGTTGA 4938 Gossyp kirkii GAACCGTGAT CATTTTGCGA TTGATCATTC TCGGTCTTTT CTTCCATTAT CGAGTAACAA ACCCCGTTG 4903 Kokia drynar GAACCGTGAT CATTTTGCGA TTGATCATTC TCGGTCTTTT CTTCAATTAT CGAGTAACAA ACCCTGTTGA 4899 4980 4990 5000 5010 5020 5030 5040 A genome CAGTGCTTTT GGACTGTGGC TCACTTCAGT CATATGTGAT CTTGGCACCT CAACTTTTAG CGAATACACT 4969 B genome CAGTGCTTTT GGACTGTGGC TCACTTCAGT CATATGTGAT CTTGGCACCT CAACTTTTAG CGAATACACT 5024 C genome CAGTGCTTTT GGACTGTGGC TCACTTCAGT CATATGTGAT CTTGGCACCT CAACTTTTAG CGAATACACT 4966 D genome CAGTGCTTTT GGACTGTGGC TCACTTCAGT CATATGTGAT CTTGGCACCT CAACTTTTAG CGAATACACT 4965 E genome CAGTGCTTTT GGACTGTGGC TTACTTCAGT CATATGTGA 5013 F genome CAGTGCTTTT GGACTGTGGC TCACTTCAGT CATATGGAAT CTTGGCACCT CAACTTTTAG CGAATACACT 5022 G genome CAGTGCTTTT GGACTGTGGC TCACTTCAGT CATATGTGAT CTTGGCACCT CAACTTTTAG CGAATACACT 5008 Gossyp kirkii CAGTGCTTTT GGCCTGTGGC TC CTTCAGT C T CTTGGCACCT CAACTTTTAG CGAATACACT 4973 Kokia drynar CAGTGCTTTT GGCCTGTGGC CACTTCAGT CA T CTCGGCACCT CAACTTTTAG CGAATACACT 4969 5050 5060 5070 5080 5090 5100 5110 A genome GTTGTCCATG TCGGCCAGGT CGCCAAGATT AATCCAGAGG CTCCACTTGA TAAAGTGTGT GTTCTTAGCT 5039 B genome GTTGTCCATG TCGGCCAGGT CGCCAAGATT AATCCAGAGG CTCCACTCGA TAAAGTGTGT GTTCTTAGCT 5094 C genome GTTGTCCATG TCGGCCAGAT CGCCAAGATT AATCCAGAGG CTCCACTTGA TAAAGTGTGT GTTCTTAGCT 5036 D genome GTTGTCCATG TCGGCCAGGT CGCTAAGATT AATCCAGAGG CTCCACTTGA TAAAGTGTGT GTTCTTAGCT 5035 E genome 5083 F genome GTTGTCCATG TCGGCCAAGT CGCCAAGATT AATCCAGAGG CTCCACTTGA TAAAGTGTGT GTTCTTAGCT 5092 G genome GTTGTCCATG TCGGCCAGAT CGCCCAGATT AATCCACAGG CTCCACTTGA TAAAGTGTGT GTTCTTAGCT 5078 Gossyp kirkii GTTGTCCATG TCGGCCAGGT CGCCAAGATT AATCCAGAGG CTCCACTTGA TAAAGTGTGT GTTCTTAGCT 5043 Kokia drynar GTTGTCCATG TCGGCCAGGT CGCCAAGATT AATCCAGAGG CTCCACTTGA TAAAGTGTGT GTTCTTAGCT 5039 5120 5130 5140 5150 5160 5170 5180 A genome GCGGAATGTC GACAGGT CC GGGCTTCACT ACAACTCGGC TTTTTTTTTT CCATTTTGGA CATATATGAA 5108 B genome GTGGAATGTC GACAGGT CC GGACTTCACT ACAACTCTAC TTTTTTT CT CCATTTTGGA TACATATGAA 5162 C genome GCGGAATGTC GACAGGT CC GGACTTCGC AACTCTGC TTTTTTT CT GCATTTTGGA TATATATGAA 5101 D genome GCGGAATGTC GACAGGT CT GGACTTCACT AAAACTTTAC TTTTTT CT CCATTTTAGA TATATATAAA 5102 E genome 5153 F genome GCGGAATGTC GACAGGT CT GGACTTCACT ACAACTCTGC TTTTTTT CT CCATTTTGGA TATATATGAA 5160 G genome GCGGAATGTC GACAGGT CC GAACTTCAC AACTCTGC TTTTTTTTCT GCATTTTGGA TATATATGAA 5144 Gossyp kirkii GCGGAATGTC CACAGGTTCC GGACTTCACT ACAACTCTGC TTTTTTTTCT TCATTTTCGA TATA G 5108 Kokia drynar GCGGAATGTC CACAGGTTCC GGACTTCACT ACAACGCTGC TTTTTTTTCT TCATTTTCAA TATA G 5104 5190 5200 5210 5220 5230 5240 5250 A genome CACATGACTT ATAGCTCATC CCTGCTTGCA GGTTTTGGTG CCACTGTGAA TGTTGCTAAA CCAAAAAAGG 5178 B genome CACATGACTT ATAGCTCATC CCTGCTTGCA GGTTTTGGTG CCACTGTGAA TGTTGCTAAA CCAAAAAAGG 5232 C genome CACATGACTT ATAGCTCATC CCTGCTTGCA GGTTTTGGTG CCACTGTGAA TGTTGCTAAA CCAAAAAAGG 5171 D genome CACATGACTT A GCTCATC TTTGCTTACA GGTTTTGGTG CCACTGTGAA TGTTGCTAAA CCAAAAAAGG 5170 E genome 5223 F genome CACATGACTT ATAGCTCATC CCTGCTTGCA GGTTTTGGTG CCACTGTGAA TGTTGCTAAA CCAAAAAAGG 5230 G genome CACATAACTT ATAGCTCATC CCTGCTTGCA GGTTTTGGTG CCACTGTGAA TGTTGCTAAA CCAAAAAAGG 5214 Gossyp kirkii CTCATCAGTC A TC C CCTGCTTGCA GGTTTCGGTG CCACTGTGAA TGTTGCTAAA CCAAAAAAGG 5172 Kokia drynar CTCATCAGTC A TC C CCTGCTTGCA GGTTTTGGTG CCACTGTGAA TGTTGCTAAA CCAAAAAAGG 5168 5260 5270 5280 5290 5300 5310 5320 A genome GTGGGTCTGT TGCAGTTTTT GGACTTGGTG CTGTAGGTCT TGCGGTAAGT TATTGTTGTT GCTTTTATGT 5248 B genome GTGGGTCTGT TGCAGTTTTT GGACTTGGTG CTGTAGGTCT TGCGGTAAGT TATTGTTGTT GCTTTTATGT 5302 C genome GTGGGTCTGT TGCAGTTTTT GGACTTGGTG CTGTAGGTCT TGCGGTAAGT TATTGTTGTT GCTTTTATGT 5241 D genome GTGGGTCTGT TGCAGTTTTT GGACTTGGTG CTGTAGGTCT TGCGGTAAGT TATTGTTGTT GCTTTTTTGT 5240 E genome 5293 F genome GTGGGTCTGT TGCAGTTTTC GGACTTGGTG CTGTAGGTCT TGCGGTAAGT TATTGTTGTT GCTTTTATGT 5300 G genome GTGGGTCTGT TGCAGTTTTT GGACTTGGTG CTGTAGGTCT TGCGGTAAGT TATTGTTGTT GCTTTTATGT 5284 Gossyp kirkii GTGGGTCTGT TGCAGTTTTC GGACTTGGTG CTGTAGGCCT TGCGGTACGT TATTGTTGTT GCTTTTATGT 5242 Kokia drynar GTGGGTCTGT TGCAGTTTTC GGACTTGGTG CTGTAGGCCT TGCGGTACTT TATTGTTGTT GCTTTTATGT 5238 5330 5340 5350 5360 5370 5380 5390 A genome TATTATCCAT CTGGCAACTA TAAAAATTGG AATTGTACTT ATTTCTATTT TGTGAAACCT AGGCTGCTGA 5318 B genome TACTATCCAT CTGGCAACTA TAAAAAT GG AGTTGTACTT ATTTCTATTT TATGAAACCT AGGCAGCTGA 5371 C genome TATTATCCAT CTGGCAACTA TAAAAAT GG AGTTGTACTT ATTTCTATTT TGTGAAACCT AGGCTGCTGA 5310 D genome TATTATCCAT TTGGCAACTA TAAAAAT AG AGTTGTACTT ATTTCTATTT TGTGAAACCT AGGCTGCTGA 5309 E genome 5363 F genome TATTATCCAT CTGGCAACTA TAAAAAT GTTGTACTT ATTTCTATTT TGTGAAACCT AGGCTGCTGA 5366 G genome TACTATCCAT CTGGCAACTG TAAAAAT GG AGTTGTACTT ATTTCTATTT TGTGAAACCT AGGCTGCTGA 5353 Gossyp kirkii TATTATCCAT CTGGCAACTA TAAAAAT GG AGTTGTACTT ATTTCTGTTT TGTGAAACCT AGGCTGCTGA 5311 Kokia drynar TATTATCCAT CTGGCAACTA TAAAAAT GG AATTGTACTT ATTTCTGTTT TGTGAAACCT AGGCTGCTGA 5307 5400 5410 5420 5430 5440 5450 5460 A genome AGGAGCAAGA GTTTGTGAGG CTTCTAGGAT CATTGGTATT GATCTAAACC CCAACAGATT CGAAGAAGGT 5388 B genome AGGAGCAAGA GTTTGTGAGG CTTCTAGGAT CATTGGTATT GATCTAAACC CCAACAGATT CGAGGAAGGT 5441 C genome AGGAGCAAGA GTTTGTGAGG CTTCTAGGAT CATTGGTATT GATCTAAACC CCAACAGATT CGAAGAAGGT 5380 D genome AGGAGCAAGA GTTTGTGAGG CTTCTAGGAT CA TTGGTATT GATCTAAACC CCAACAGATT CGAAGAAGGT 5379 E genome 5433 F genome AGGAGCAAGA GTTTGTGAGG CTTCTAGGAT CATTGGTATT GATCTAAACC CCAACAGATT CGAAGAAGGT 5436 G genome AGGAGCAAGA TTTTGTGAGG CTTCTAGGAT CATTGGTATT GATCTAAACC CCAACAGATT CGAAGAAGGT 5423 Gossyp kirkii AGGAGCAAGA GTTTGTGAGG CTTCTAGGAT CATTGGTATT GATCTGAACC CCAACAGATT CGAAGAAGGT 5381 Kokia drynar AGGAGCAAGA GTTTGTGAGG CTTCTAGGAT CATTGGTATT GATCTGAACC CCAACAGATT CGAAGAAGGT 5377 5470 5480 5490 5500 5510 5520 5530 A genome AGCTTTAGTT TAATTGATAT TTACATTAAA TACTCAAA G ACTGGTTATG TTTTAGATTA AACAAAGTTG 5457 B genome AGCTT ATTT TAATTGATAT TTACATTAAA TACTCAAA G ACTGGTTATG TTTTAGATTA AACAAAGTTG 5509 C genome AGCTTTAGTT TAATTGATAT TTACATTAAA TACTCAAA G ACTGGTTATG TTTTAGATTA AACAAAGTTG 5449 D genome AGGTTTATTT TAATTGATAT TTACATTAAA CACTCAAA G ATTGGTTATG TTTCAGATTA AACAAAGTTG 5448 E genome 5503 F genome AGCTTTAGTT TAATTGATAT TTACATTAAA TACTCAAA G ACTGGTTATG TTTTAGATTA AACAAAGTTG 5505 G genome AGCTTTAGTT TAAT GATAT TTACATTAAA TACTCAAA G ACTGGTTATG TTTTAGATTA AACAAAGTTG 5491 Gossyp kirkii ATCTTTAGTT TAATTGTTCT TTTCATTAAG CACTCAAAAG ACTGGTTATA TTCCAGATTA AACAAAGTTG 5451 Kokia drynar ATCTTTAGTT TAATTGTTCT TTTCATTAAG CACTCAAA G ACTGGTTATG TTCCAGATTA AACGAAGTTG 5446 5540 5550 5560 5570 5580 5590 5600 A genome CAAAATTAAT CATTTTTCTT CTTGCAGCCA AGAAATTTGG TTGTACCGAG TTTGTGAACC CAAAAGATCA 5527 B genome CAAAATTAAT CATTTTTCTT CTTGCAGCCA AGAAATTTGG TTTTACCGAG TTTGTGAACC CAAAAGATCA 5579 C genome CAAAATTAAT CATTTTTCTT CTTGCAGCCA AGAAATTTGG TTGTACCGAG TTTGTGAACC CAAAAGATCA 5519 D genome CAAAATTAAT CATTTTTCTT CTTGCAGCCA AGAAATTTGG TTGTACTGAG TTTGTGAACC CAAAAGATCA 5518 E genome 5573 F genome CAAAATTAAT CATTTTTCTT CTTGCAGCCA AGAAATTTGG TTGTACCGAG TTTGTGAACC CAAAAGATCA 5575 G genome CAAAATTAAT CATTTTTCTT CTTGCAGCTA AGAAATTTGG TTCTACCGAA TTTGTGAACC CAAAAGATCA 5561 Gossyp kirkii CAAAATTAAT TTTCTT CTTGCAGCCA AGAAATTTGG TTGTACCGAG TTTGTGAACC CGAAAGATCA 5517 Kokia drynar CAAAATTAAT AATTTTTCTT CTTGCAGCCA AAAAATTTGG TTGTACCGAG TTTGTGAACC CGAAAGATCA 5516 5610 5620 5630 5640 5650 5660 5670 A genome TAATAAACCT GTTCAAGAGG TTGGATTCCT TGAAAACTCA ATCCCATATA CCTTACTGAA CTTTGAGC 5595 B genome TAATAAACCT GTTCAAGAGG TTGGATTCCT TGAAAACTCA ATCCCATATA CCTTACTAAA CTTTGAGC 5647 C genome TAATAAACCT GTTCAAGAGG TTGGATTCCT TGAAAACTCA ATCCCATATA CCTTACTGAA CTTTGAGC 5587 D genome CAATAAACCT GTTCAAGAGG TTGGATTCCT TGAAAACTCA ATCCCATATA CCTTACTGAA CTTTGAGC 5586 E genome 5643 F genome TAATAAACCT GTTCAAGAGG TTGGATTCCT TGAAAACTCA ATCCCATATA CCTTACTGAA CTTTGAGC 5643 G genome TAATAAACCT GTTCAAGAGG TTGGATTCCT TGAAAACTCA ATCCCATATA CCTTAGTGAA CTTTGAGC 5629 Gossyp kirkii CGATAAACCT GTTCAAGAGG TTGGATTCCT TGAAAACTCA ATCCCATATA CATAACTGAA AACTTTGAGC 5587 Kokia drynar CAATAAACCT GTTCAGGAGG TTGGATTCCT TGAAAACTCA ATCCCATATA TATAACTGAA AACTTTGAGC 5586 5680 5690 5700 5710 5720 5730 5740 A genome ACGTAAAGTC ATTAAAGATT CTGGCATGAC CATTTATTTA GTTAGGTCAT CTTACATAAC AAAACTTGCA 5665 B genome ACGTAACGTC ATTAAAGATT CTGGCATGAC CATATATTTA GTTAGGTCAT CTTACATAAT AAAACTTGCA 5717 C genome GCGTAAAGTC ATTAAAGATT CTGGCATGAC CATATATTTA G GTCAT CTTACATGAT AAAACTTGCA 5653 D genome ATGTAAAATC ATTAAAGATT CTGGCATGAC CATATATTTA GTTAGGTCAT CTTACATAAT AAAACTTGCA 5656 E genome 5713 F genome ACGTAAAGTC ATTAAAGATT CTGGCATGAC CATATATTTA GTTAGGTCAT CTTACATAAT AAAACTTGCA 5713 G genome ACGTAAAGTC ATTAAAGATT CTAGCATGAC CATATATTTA G GTCAT CTTACATAAT AAAACTTGCA 5695 Gossyp kirkii ACATCAAATC ATTAAAGATT CTGGCATGAC CATACACTTA GTTAGGTCAT CTTACATAAT AAAACCTGCA 5657 Kokia drynar ACGTCAAATC ATTAAAGATT CTGGCATGAC CATACACTTA GTTAGGTCAT CTTACATAAT AAAACCTGCA 5656 5750 5760 5770 5780 5790 5800 5810 A genome TTGTTG CTGAGTTT TCAAGTAGAT AGATAATTTT GTTTCTTGTT GTTCTAACAA ATAGGTGATT 5729 B genome TTGTTG CTGAGTTT TCAAGCAGAT AGATAATTTT GTTTCTTGTT GTTCTAACAA ATAGGTGATT 5781 C genome TTGTTG CTGAGTTT TCAAGCAGAT AGATAATTTT GTTTCTTGTT GTTCTAAGAA ATAGGTGATT 5717 D genome TTGTTGGAGT TGCTGAGTTT TCAAGCAGAT AGATAATTTT GTTTCTTGTC GTTCTAAAAA ATAGGTGATT 5726 E genome 5783 F genome TTGTTG CTGAGTTT TCATGTAGAT AGATAATTTT GTTTCTTGTT GTTCTAACAA ATAGGTGATT 5777 G genome TTGTTG CTGAGTTT TCAAGCAGAT AGATAATTTT GTTTCTTGTT GTTCTAACAA ATAGGTGATT 5759 Gossyp kirkii TTGTTGGAGT TGCTGAGTTT TCAAACAGAC GGATAATTTT GTTACTTGTT ATTCTAACAA ATAGGTGATT 5727 Kokia drynar TTGTTGGAGT TTCTGAGTTT TCAAACAGAC AGATAATTTT GTTACATGTT GTTCTAACAA ATAGGTGATT 5726 5820 5830 5840 5850 5860 5870 5880 A genome TCGGAGATGA CTGGAGGAGG AGTTGATTGC AGTATTGAAT GTACGGGGAG CACCCAGGCC ATGGTTTCTG 5799 B genome GCGGAGATGA CTGGAGGAGG AGTTGATTGC AGTATTGAAT GTACGGGGAG CACCCAGGCC ATGGTTTCTG 5851 C genome GCGGAGATGA CTGGAGGAGG AGTTGATTGC AGTATTGAAT GTACGGGGAG CACCCAGGCC ATGGTTTCTG 5787 D genome GCGGAGATGA CTGGAGGAGG AGTTGATTGC AGTATTGAAT GTACGGGGAG CACCCAGGCC ATGGTTTCTG 5796 E genome 5853 F genome GCGGAGATGA CTGGAGGAGG AGTTGATTGC AGTATTGAAT GTACGGGGAG CACCCAGGCC ATGGTTTCTG 5847 G genome GCGGAGATGA CTGGAGGAGG AGTTGATTGC AGTATTGAAT GTACGGGGAC CACCCAGGCC ATGGTTTCTG 5829 Gossyp kirkii GCGGAGATGA CTGGAGGAGG AGTTGATTGC AGTATTGAAT GTACAGGGAG CATCCAGGCC ATGATTTCTG 5797 Kokia drynar GCAGAGATGA CTGGAGGAGG AGTTGATTGC AGTATTGAAT GTACAGGGAG CATCCAGGCC ATGATTTCTG 5796 5890 5900 5910 5920 5930 5940 5950 A genome CATTTGAATG TGTCCATGAT GTAATTACCA GCACAAACTT CTCCTCATTC TTAGACATTT TATTTTAAAC 5869 B genome CATTTGAATG TGTCCATGAT GTAATTACCA GCAC CTTCATTC ATAGACATTT TATTTTAAAC 5913 C genome CATTTGAATG TGTCCATGAT GTAATTACCA GCACAAACTT CTCTTCATTC ATAGACATTT TATTTTAAAC 5857 D genome CATTTGAATG TGTCCATGAT GTAATTACCA GCACAAACTT CTCTTCATTC ATAGACATTT TATTTTAAAC 5866 E genome AC 5923 F genome CATTTGAATG TGTCCATGAT GTAATTACCA GCACAAACTT CTCTTCATTC ATAGACATTT TATTTTAAAC 5917 G genome CATTTGAATG TGTCCATGAT GTAATTACCA GCACAAACTT CTCTTCATTC ATAGACATTT TATTTTAAAC 5899 Gossyp kirkii CATTTGAATG TGTCCATGAT GTAATTACCA GCACAAACTT CTCTTCATTC ATGGACATTT TATTTTAAAC 5867 Kokia drynar CATTTGAATG TGTCCATGAT GTAATTACCA GCACAAACTT CTCTTCATTC ATGGACATTT TATTTTAAAC 5866 5960 5970 5980 5990 6000 6010 6020 A genome TTCAATACGA CGAGGAACCC ACTCATCCTT CTGCTCTCTG TGCCCAAGCC TGCATAAGTG ATGAAGGAAT 5939 B genome TTCAATACGA CGAGGAACCC ACTCATCCTT CTGCTCTCTG TGCCCAAGCC TCCATAAGTG ATGAAGGAAT 5983 C genome TTCAACACGA CGAGGAACCC ACTCATCCTT CTGCTCTCTG TGCCCAAGCC TGCATAAGTG ATGAAGGAAT 5927 D genome TTCAACACGA CGAGGAACCC ACTCATCCTT CTGCTCTCTG TGCCCAAGCC TGCATAAGTG ATGAAGGAAT 5936 E genome TTCAACACGA CGAGGAACCC ACTCATCCTT CTGCTCTCTG TGCCCAAGCC TGCATAAGTG ATGAAGGAAT 5993 F genome TTCAATACGA CGAGGAACCC ACTCATCCTT CTGCTCTCTG TGCCCAAGCC TGCATTAGTG ATGAAGGAAT 5987 G genome TTCAACACGA CGAGGAACCC ACTCATCCTT CTGCTCTCTG TGCCCAAGCC TGCATAAGTG ATGAAGGAAT 5969 Gossyp kirkii TTCAACACGA CGAGGAAACC ACTCATCCTT CTGCTCTCTG TGCCCAAGCC TGCATAAGTG ATGAAGG AT 5936 Kokia drynar TTCAACACGA CAAGGAAACC ACTCATCCTT CTGCTCTCTG TGCCCAAGCC TGCATAAGTG ATGAAGG AT 5935 6030 6040 6050 6060 6070 6080 6090 A genome TGCATCAAGG AAACAAAAGG AAAAACAAAT AAGTAGAATA AAGGATTTAA GCCC GTAAA AACACATCAA 6008 B genome TGCATCAAGG AAACAAAAGA AAAAACAAAT AAGTAGAATA AAGGATTTAA GCCCTGTAAA AACACATCAA 6053 C genome TGCATCAAGG AAACAAAAGG AAAAACAAAT AAGTAGAATA AAGGATTTAA GCCCTGTAAA CCACATCAA 5996 D genome TGCGTCAAGG AAACAAAAGG AAAAACAAAT AAGTAGAATA AAGGATTTAA GCCCTGTAAA AACACATCAA 6006 E genome TACATCAAGG AAACAAAAGG AAAAACAGAT AAGTAGAATA AAGGATTTAA GCCCTATAAT AACACATCAA 6063 F genome TGCATCAAGG AAACAAAAGG AAAAACAAAT AAGTAGAATA AAGGATTTAA GCCCTGTAAA AACACATCAA 6057 G genome TGCATCAAGG AAACAAAAGG AAAAACAAAT AAGTAGAATA AAGGATTTAA GCCCTGTAAA ACACATCAA 6038 Gossyp kirkii AGCATCAAGG AAACAAAAGG AAAAACAAAT AAGTAGAATA AAGGATTTAA GCCCTGTAAA AACACATCAA 6006 Kokia drynar TGCATCAAGG AAACAAAAGG AAAAACAAAT AAGTAGAATA AAGGATTTAA GCCCTGTAAA AGCACATCAA 6005 6100 6110 6120 6130 6140 6150 6160 A genome ATACTGGAAC AATGCAGAAG TTAGCAGTGG TGAACATGTC ACGAACCTT CCATAAC 6064 B genome ATACTGGAAC AATGCAGAAG TTAGCAGTGG TGAACATGTC ACAAACCTT CCATAAC 6109 C genome ATACTGGAAC AATGCAGAAG TTAGCAGTGG TGAACATGTC ACAAACCTT CCATAAC 6052 D genome ATACTGGAAC AATGCAGAAG TTAGCAGTGG TGAGCATGTC ACAAACCTT CCATAAC 6062 E genome ATACTGGAAC AATGCAGAAG TTAGCAGTGG TGAGCATGTC ACAAACCTT CCATAAC 6119 F genome ATTCTGGAAC AATGCAGAAG TTAGCAGTGG CGAACATGTC ACAAACCTT CCATAAC 6113 G genome ATACTGGAAC AATGCAGAAG TTAGCAGTGG TGAACATGTC ACAAACCTT CCATAAC 6094 Gossyp kirkii ATACTGGAAC AATGCAGAAG TTAGCAGTGG TGAGCATGTC ACAAACCTT CCATAAC 6062 Kokia drynar ATACTGGAAC AATGCAGAAG TTAACAGTGG TGAGCATGTC ACAAACCTTC CAATACCTCC CTTCCATAAC 6075 6170 6180 6190 6200 6210 6220 6230 A genome CACCAAAGCC CCACCTAGAC AATCACATAA TAAAAGTAAA TTGTTTATGA ACAAGGAAAA TAAAAGGGAT 6134 B genome CACCAAAGCC CCACCTAGAC AATCACATAA TAAAAGTAAA TTATTTATGA ACAAGGAAAA TAAAAGGAAA 6179 C genome CACCAAAGCC CCACCTAGAC AATCACATAA TAAAAGTAAA TTGTTTATGA ACAAGGAAAA TAAAAGGGAA 6122 D genome CGCCAAAGCC CCACCTAGAC AATCACATAA TAAAAGTAAA TTGTTTATGA ACAAGGAAAA TAAAAGGGAA 6132 E genome CACCAAAGCC CCACCTAGAC AATCACATAA TAAAAGTAAA TTGTTTATGA ACAAGGTAAA TAAAAGGGAA 6189 F genome CACCAAAGCC CCACCTAGAC AATCACATAA TAAAAGTAAA TTGTTTATGA ACAAGGAAAA TAAAAGGGAA 6183 G genome CACCAAAGCC CCACCTAGAC AATCACATAA TAAAAGTAAA TTGTTTATGA ACAAGGAAAA TAAAAGGGAA 6164 Gossyp kirkii CACCAAAACC CCACCTGGAC AATCACATAA TAAAAGTAAA TTGTTTATGA ACAAGGAAAA TAAATGGGAA 6132 Kokia drynar CACCAAAGCC CCACCTAGAC AATCACATAA TAAAAGTAAA TTGTTTATGA ACAAGGAAAA TAAAAGGGAA 6145 6240 6250 6260 6270 6280 6290 6300 A genome ATCTAAAACC ATAACACAAT AATCAACAAT GACTTACGTG AAAACATAGC CATTCATGTC CACAGCAACT 6204 B genome ATCTAAAACC TTAACACAAT AATCAACAAT GACTTACGTG TAAACATAGC CATTCGTGTC CACGGCAACT 6249 C genome ATCTAAAACC TTAACACAAT AATCAACAAT GACTTACGTG TAAACATAGC CATTCGTGTC CACAGCAACT 6192 D genome ATCTAAAACC TTACCACAAT AATCAACAAT GACTTACGTG TAAACAAAGC CATTTGTGTC CACAGCAACT 6202 E genome ATCTAAAACC TTAACACAAT AATCAACAAT GACTTACGTG TAAACATAGC CATTCGTGTC AACAGCAACT 6259 F genome ATCTAAAACC TTAACAAAAT AATCAACAAT GACTTACGTG TAAACATAGC CATTCGTGTC CACAGCAACT 6253 G genome ATCTAAAACC TTAACACAAC AATCAACAAT GACTTACGTG TAAACATAGC CATTCGTGTT CACAGCAACT 6234 Gossyp kirkii ATCTAAAACC TTACC AAT AATCAACAAT GACTTACGTG TAAACATAGC CATTCGTGTC CACAGCAACT 6200 Kokia drynar ATCTAAAACC TTACC AAT AATCAACAAT GACTTACGTG TAAACATAGC CATTCGTGTC CACAGCAACT 6213 6310 6320 6330 6340 6350 6360 6370 A genome GGATGCACAA ATTAGAAAAG TAAACAATGA GATGAAT GT TTAAGTAAAA GAAGAACCAG GGAGAGGGAA 6273 B genome GGATGCACAA ATTAGAAAAG TAAACAATGA GATGAAT GT TTAAGTAAAA GAAGAACCAG GAATAGGGAA 6318 C genome GGATGCACAA ATTAGAAAAG TAAACAATGA GATGAAT GT TTAAGTAAAA GAAGAACCAG GGATAGGGAA 6261 D genome GGATGCACAA ATTAGAAAAG TAAACAATGA GATGAAT GT TTAAGTAAAA GAAGAACCAG GGATAGGGAA 6271 E genome GGATGCACAA ATTAGAAAAG TAAACAATGA GATGAAT GT TTAAGTAAAA GAAGAACCAG GGATAGGGAA 6328 F genome GCATGCACAA ATTAGAAAAG TAAACAATGA GATGAAT GT TTAAGTAAAA GAAGAACCAG GGATAGGGAA 6322 G genome GGATGCACAA ATTGGAAAAG TAAACAATGA GATGAAT GT TTAAGTAAAA GAAGAACCAG GGATAGGGAA 6303 Gossyp kirkii GGATGCACAA ATTAGAAAAG TAAACAATGA GATGAAT GT TTAAGTAAAA GAAGAACTGG GGATAGGGAA 6269 Kokia drynar GGATGCACAA ATTAGAAAAG TAAACAAT GAATTGT TTAAGTAAAA GAACTGG GGATAGGGAA 6275 6380 6390 6400 6410 6420 6430 6440 A genome GGGGATGACC AAAAGATGAA AGAGCAAATG AACATGAAAG AGAGCAGGCA TATCATGAAC CTGTATGGTT 6343 B genome GGGGATGACC AAAAGATGAA AGAGCAAATG AACATGAAAG AGAGCAGGCA TATCATGAAC CTGTATGGTT 6388 C genome GGGGATGACC AAAAGATGAA AGAGCAAATG AACATGAAAG AGAGCAGGCA TATCATGAAC CTGTATGGTT 6331 D genome GGGAACGACC AAAAGATGAA AGAGCAAATG AACATGAAAG AGAGCAGGCA TATCATGAAC CTGTATGGTT 6341 E genome GGGGATGACC AAAAGATGAA AGAGCAAATG AACATGAAAG AGAGCAGGCA TATCATGAAC CTGTATGGTT 6398 F genome GGAGATGACC AAAAGATGAA AGAGCAAATG AACATGAAAG AGAGCAGGCA TATCATAAAC CTGTATGGTT 6392 G genome GGGGATGACC AAAAGATGAA AGAGCAAATG AACATGAAAG AGAGCAGGCA TATCATGAAC CTGTATGGTT 6373 Gossyp kirkii GGGGATGACC AAAAGATGAA AGAGCAGATG AACATGAAAG AGAGCAAGCA TATCATGAAC CTGTATGGTT 6339 Kokia drynar GGGGATGACC AAAAGATGAA AGAGCAGATG AACATGAAAG AGAGCAAGCA TATCATGAAC CTGTATGGTT 6345 6450 6460 6470 6480 6490 6500 6510 A genome TGTTCCACAG GCAACTTTGA CAATAGTTTC CCCAGAAAGA GTAGCTATAG CTCTAGGGCG AGGTTGAGAT 6413 B genome TGTTCCACAG GCAACTTTGA CAATAGTTTC TCCAGAAAGA GTAGCTATAG CTCTAGGGCG AGGTTGAGAT 6458 C genome TGTTCCACAG GCAACTTTGA CAATAGTTTC CCCAGAAAGA GTAGCTATAG CTCTAGGGCG AGGTTGAGAT 6401 D genome TGTTCCACAG GCAACTTTGA TAATAGTTTC CCCAGAAAGA GTAGCTATAG CTCTAGGGCG AGGTTGAGAT 6411 E genome TGTTCCACAG GCAACTTTGA CAATAGTTGC CCCAGAAAGA GTAGCTATAG CTCTAGGGCG AGGTTGAGAT 6468 F genome TGTTCCACAG GCAACTTTGA CAATAGTTTC CCCAGAAAGA GTAGCTATAG CTCTAAGGCG AGGTTGAGAT 6462 G genome TGTTCCACAG GCAACTTTGA CAATAGTTTC CCCAGAAAGA GTAGCAATAG CTCTAGGGCG AGGTTGAGAT 6443 Gossyp kirkii TGTTCCACAG GCAACTTTGA CAATAGTTTC CCCAGAAAGA GTAGCTATAA CTCTAGGGCG AGGTTGAGGT 6409 Kokia drynar TGTTCCACAG GCAACTTTGA CAATAGTTTC CCCAGAAAGA GTAGCTATAA CTCTAGGGCG AGGTTGAGGT 6415 6520 6530 6540 6550 6560 6570 6580 A genome TCATAAACAA GCCTCACCGA GCTATCCTTG GCATTATACT GCAAGCGTAT AGGTATGATG CAAACACCCG 6483 B genome TCATAAACAA GCCTCACCGA GCTATCCTTG GCATTATACT GCAAGTGTAT AGGTATGATG CAAACACCCG 6528 C genome TCATAAACAA GCCTCACCGA GCTATCCTTG GCATTATACT GCAAGCGTAT AGGTATGATG CAAACACCCG 6471 D genome TCATAAACAA GCCTCACCGA GCTATCCTTG GCATTATACT GCAAGCGTAT AGGTATGATG CAAACACCCG 6481 E genome TCATAAACAA GCCTCACCGA GCTATCCTTG GCATTATACT GCAAGTGTAT AGGTATGATG CAAACACCCG 6538 F genome TCATAAACAA GCCTCACCGA GCTATCCTTG GCATTATACT GCAAGCGTAT AGGTATGATG CAAACACCCG 6532 G genome TCATAAACAA GCCTCACCGA GCTATCCTTG GCATTATACT GCAAGCGTAT AGGTATGATG CAAACACCCG 6513 Gossyp kirkii TCATAGACAA GCCTCACCGA GCTATCCTTG GCATTATACT ACAAGCGTGT AGGTATTATG CAAACACCCA 6479 Kokia drynar TCATAGACAA GCCTCACCGA GCTATCCTTG GCATTATACT GCAAGGGTGT AGGTATGATG CAAACACCCA 6485 6590 6600 6610 6620 6630 6640 6650 A genome TGGAGAAAAG CAAGTCAATA GCAACTAGGT TAGAGAACTG CTTAACCACT TCTAGATATC AAATAACACA 6553 B genome TGGAGAAAAG CAAGTCAATA GCAACTAGGT TAGAGAACTG CTTAACAACT TCTAGATATC AAATAACACA 6598 C genome TGGAGAAAAG CAAGTCAATA GCAAC CACCT TCTAGATATC AAATAACACA 6541 D genome TGGAGAAAAG CAAGTCAATA GCAACTAGAT TAGAGAACTG CTTAACAACT TCTAGATATC AAATAACACA 6551 E genome TAGAGAAAAG CAAGTCAATA GCAACTAGGT TAGAGAACTG CTTAACAACT TCTAGATATC AAATAACACA 6608 F genome TGGAGAAAAG CAAGTCAATA GCAACTAGGT TAGAGAACTG CTTAACAACT TCTAGATATC AAATAACACA 6602 G genome TGGAGAAAAG CAAGTCAATA GCAACTAGGT TAGAGAACTG CTTAACACCT TCTAGATATC AAATAACACA 6583 Gossyp kirkii TTGAGAAAAG CAAGTCAATA GCAACTAGGT TAGAGAACTG CTTAAAAAAT TCTAGATATC AAATAACACA 6549 Kokia drynar TTGTGAAAAG CAAGTCAATA GCAACTACGT TAGAGAACTG CTTAAAAAAT TCTAGATATC AAATAACACA 6555 6660 6670 6680 6690 6700 6710 6720 A genome TATAAAAGTG GTGTAAAATC AAAAACTCAG GATCTAATAA AAGAAATTGT CTTGATTAAT TTGAACTTAG 6623 B genome TATAAAAGTG GTGTAAAATA AAAAACTCAG GATCTAAGAA AAGAAATTGT CTTGATTAAT TTGAACTTAG 6668 C genome TATAAAAGTG GTATAAAATC AAAAACTCAG GATCTAAGAA AAGAAATTGT CTTGATTAAT TTGAACTTAG 6611 D genome TATAAAAGTG GTGTAAAATC AAAAACTCAG GATCTAAGAA AAGAAATTGT CTTGATTAAT TTGAACTTAG 6621 E genome TATAAAAGTG GTGTAAAATC AAAAACTCAG GATCTAAGAA AAGAAATTGT CTTGATTAAT TTTAACTTAG 6678 F genome TATAAAAGTG GTGTAAAATC AAAAACTCAG GTTCTAAGAA AAGAAATTGT CTTGATTAAT TTGAACTTAG 6672 G genome TATAAAAGTG GTGTAAAATC AAAAACTCAG GATCTAAGAA AAGAAATTGT CTTGATTAAT TTGAACTTAG 6653 Gossyp kirkii TATAAAAGTG GTGTAAAATA AAAAACTCAG GAACTAAGAA AAGAAATTGT CTTGATCAAT TTGAACTTAG 6619 Kokia drynar TATAAAAGTG GTGTAAAATC AAAAACTCAG GATCTAAGAA AAGAAATTGT CTTGATCAAT TTGAACTT 6623 6730 6740 6750 6760 6770 6780 6790 A genome AGGGAGAAAA TAAGGTAAAA GAAATGCAAA AGATACTAAA CGAATGTGGT AGTAGGAAAC AAATGCATAT 6693 B genome AGGGAGAAAA TAAGGTAAAA GAAATGCAAA AGATACTAAA CGAATGTGGT AGTAGGAAAC AAATGCATAT 6738 C genome AGGGAGAAAA TAAGGTAAAA GAAATGCAAA AGATACTAAG CGAATGTGGT AGTACGAAAC AAATGCATAT 6681 D genome AGGGAGAAAA TAAGGTAAAA GAAATGCAAA AGATACTAAA CGAATGTGGT AGTAGGAAAC AAATGCATAT 6691 E genome AGGGAGAAAA AAAGGTAAAA GAAATGCAAA AGATACTAAA CGAATGTGGT TGTAGGAAAC AAATGCATAT 6748 F genome AGGGAGAAAA TAAGGTAAAA GAAATGCAAA AGATACTAAA CGAATGTGGT AGTAGGAAAC AAATGCATAT 6742 G genome AGGGAGAAAA TAAGGTAAAA GAAATGCAAA AGATACTAAG CGAATGTGGT AGTAGGAAAC AAATGCATAT 6723 Gossyp kirkii AGGGAGAAAA TAAGGTAAAA GAAATGCAAA AGATACAAAA CAGATGTGGT AGTAGGAAAA AAATGAATAT 6689 Kokia drynar GGAGAAAA TAAGGTAAAA GAAATGCAAA AGATACAAAA CAGATGTGGT AGTAGGAAAC AAATGCATAT 6691 6800 6810 6820 6830 6840 6850 6860 A genome AGAGAAGTAA CAGCAGCAGT ATAAGTTAAA TATGAAGAAC AAATTGATCA ATGTAAGAAT GTGCTAAAAA 6763 B genome AAAGAAGTAA CAGCAGCAGC ATAAGTTAAA TATGAAGAAC AATTTGATCA ATGTAAGAAT GTGCTAAAAA 6808 C genome AAAGAAGTAA CAGCAGCAGC ATAAGTTAAA TATGAAGAAC AAATTGATCA ATGTAAGAAT GTGCTAAAAA 6751 D genome AAAGAAGTAA CACCAGCAGC ATAAGTTAAA TATGAAGAAC AAATTGATCA ATGTAAGAAT GTGCTAAAAA 6761 E genome AAAGAAGTAA CAGCAGCAGC ATAAGTTAAA TATGAAGAAC AAATTGATCA ATGTAAGAAT GTGCTAAAAA 6818 F genome AAAGAAGTAA CAGCAGCAGC ATAAGTTAAA TATGAAGAAC AAATTGATCC ATGTAAGAAT GTGCTAAAAA 6812 G genome AAAGAAGTAA CAGCAGCAGC ATAAGTTAAA TATTAAGAAC AAATTGATCA ATGTAAGAAT GTGCTAAAAA 6793 Gossyp kirkii AAAGAAGCAA CAGCAGCAGC ATAAGTTAAA TATGAAGAAC AAATTGATCA ATGTAAGAAT GTGCTAAAAA 6759 Kokia drynar AAAGAAGCAA CAGCAGCAGC ATAAGTTAAA TATGAAGAAC AAATTGATCA ATGTAAGAAT GTGCTGAAAA 6761 6870 6880 6890 6900 6910 6920 6930 A genome CACAATTTTT ATAAGAGTAG GATGGCTTTT TGGTGTTTTG GCCTTCACTT AACAAGGCTC CCTTTATTTG 6833 B genome CACAATTTTT ATAAGAGTAG GATGGCTTTT TGGTGTTTTG GCCTTTACTT AACAAGGCTC CCTTTATTTG 6878 C genome CACAATTTTT ATAAGAGTAG GATGGCTTTT TGGTGTTTTG GCCTTTACTT AACAAGGCTC CCTTTATTTG 6821 D genome CACAATTTTC ATAAGAGTAG GATAGCTTTT TGCTGTTTTG GCCTTTACTT AACAAGGCTC CCTTTATTTG 6831 E genome CACAATTTTT ATAAGAGTAG GATGGCTTTT TGGTGTTTTG GCCTTTACTT AACAAGGCTC CCTTTATTTG 6888 F genome CACAATTTTT ATAAGAGTAG GATGGCTTTT TGGTGTTTTG GCCTTCACTT AACAAGGCTC CCTTTATTTG 6882 G genome CACAATTTTT ATAAGAGTAG GATGGCTTTT TGGTGTTTTG GCCTTTACTT AACAAGGCTC CCTTTATTTG 6863 Gossyp kirkii CACAATTTTT ATAAGAGTAG GATGGCTTTT TGGTGTTTTG GCCTTTACTT AACAAGGCTC CCTTTATTTG 6829 Kokia drynar CACAATTTTT ATAAGAGTAG GATGGCTTTT TGGTGTTTTG GCCATTACTT AACAAGGCTC CCTTTATTTG 6831 6940 6950 6960 6970 6980 6990 7000 A genome AGCCTTTGCT GCTAGCTTTG TACATCCTCA CATTTTGCAA AAGAGTAAAA ATTGAAAAGC AAAAACTATA 6903 B genome AGCTTTTGCT GCTAGCTTTG TACATCCTCA CATTTTGCAA AAGAGTAAAA ATGGAAAAGC AAAAACTATA 6948 C genome AGCTTTTGCT GCTAGCTTTG TACATCCTCA CATTTTGCAA AAGAGTAAAA ATTGAAAAGC AAAAACTATA 6891 D genome AGCTTTTGCT GCTAGCTTAG TACATCCTCA CATTTTGCAA AAGAGTAAAA ATTGAAAAGC AAAAACTATA 6901 E genome AGCTTTTGCT GCTAGCTTTG TACATCCTCA CATTTTGCAA AAGAGTAAAA ATTGAAAAGC AAAAACTATA 6958 F genome AGCTTTTGCT GCTAGCTTTG TACATCCTCA CATTTTGCAA AAGAGTAAAA ATTGAAAAGC AAAAACTATA 6952 G genome AGCTTTTGCT GCTAGCTTTG TACATCCTCA CATTTTGCAA AAGAGTAAAA ATTGAAAAGC AAAAACTATA 6933 Gossyp kirkii AACTTTTGCT ACTAGCTCTG TACATCCTCA CATTTTGCAA AAAAGTAAAA AGTGAAAAGC AAAAACTATA 6899 Kokia drynar AGCTTTTGCT ACTAGCTCTG TACATCCTCA CATTTTGCAA AAGAGTAAAA AGTGAAAAGC AAAAACTATA 6901 7010 7020 7030 7040 7050 7060 7070 A genome TGTCATTAAA ATCAAGCACA TTTCCAAACA ATAGCTCTGA TTCAGGCACA ATTATGTGAT GCAATATAAA 6973 B genome TGTCATTAAA ATCAAGCACA TTTCCAAACA ATAGCTCTGA TTCAGGCACA ACTATGTGAT GCAATATAAA 7018 C genome TGTCATTAAA ATCGAGCACA TTTCCAAACA ATAGCTCTGA TTCAGGCACA ATTATGTGAT GCAATATAAA 6961 D genome TGTCATTAAA ATCGAGCACA TTTCCAAACA ATAGCTCTGA TTCAGGCACA ATTATGTGAT GCAATATAAA 6971 E genome TGTCATTAAA ATCGAGCACA TTTCCAAACA ATAGCTCTGA TTCAGGCACA ATTATGTGAT GCAATATAAC 7028 F genome TGTCATTAAA ATCAAGCACA TTTCCAAACA ATAGCTCTGA TTCAGGCACA ATTATGTCAT GCAATATAAA 7022 G genome TGTCATTAAA ATCGAGCACA TTTCCAAACC ATAGCTCTGA TTCAGGCACA ATTATGTGAT GTAATATAAA 7003 Gossyp kirkii TGTCATTAAA AACGAACACA TTGCCAAACA ATCACTCTGA TTCAGGCACA ATTATGTGAT GCAATATAAA 6969 Kokia drynar TGTCATTAAA ATCGAACACA TTGCCAAACA ATCACTCTGA TTCAGGCACA ATTATGTGAT GCAATATAAA 6971 7080 7090 7100 7110 7120 7130 7140 A genome TGAAGCTTCT ATTACCTTTA AAATAAAGCT TTTAATTT ACACTCTTAT AAAATGTTTC TTGTTTTTGT 7041 B genome TGAAGCTTCT ATTACCTTTA AAATAAAGCT TTTAATTTCT ACACACTTAT AAGATGTTTC TTGTTTTTGT 7088 C genome TGAAGCTTCT ATTACCTTTA AAATAAAGCT TTTAATTT ACACTCTTAT AAAATGTTTC TTGTTTTTTT 7029 D genome TGAAGCTTCT ATTACCTTTA AAATAAAGCT TTTAATTT ACACTCTTAT AAAATGTTTC TTGTTTTTGT 7039 E genome TGAAGCTTCT ATTACCTTTA AAATAAAGCT TTTAATTT ACACTCTTAT AAAATGTTTC TTTTTTTTCT 7096 F genome TGAAGCTTCT ATTACCTTTA AAATAAAGCT TTTAATTT ACACTCTTAT AAAATGTTTC TTGTTTTTGT 7090 G genome TGAAGCTTCT ATTACCTTTA AAATAAAGCT TTTAATTT ACACTCTTAT AAAATGTTTC TTGTTTTTGT 7071 Gossyp kirkii TGAAACTTCT ATTACCTTTA AAATAAAGCT TTTAATTT ACACTCTTGT AAAATGTTTC TTGTTTTTGC 7037 Kokia drynar TGAAGCTTCT ATTACCTTTA AAATAAAGCT TTTAATTT ACACTCTTGT AAAATGTTTC TTGTTTTTGC 7039 7150 7160 7170 7180 7190 7200 7210 A genome ATCCAAATCC CTTTCTTCTT TTT ATTTAT TTTTTTTCTT TTTTACTTGC AAAGTAGCAA AATCAACAAT 7110 B genome ATCCAAATCC CTTTCTACTT TTT ATTTA TTTTTTTCTT TTTTACTTGC AAAGTAGCAA AATCAACAAT 7156 C genome ATCCAAATCC CTTTCTTCTT TTT ATTTA TTTTTTTCTT TTTTACTTGC AAAGTAGCAA AATCAACAAT 7097 D genome ATCCAAATCC CTTTCTTCTT TTTTA TTTTTTTCTT TTTTACTTGC AAAGTAGCAA AATCAACAAT 7104 E genome ATCCAAATCC CTTTCTTCTT T TTTTTTTCTT TGCTACTTGC AAAGTAGCAA AATCAACAAT 7157 F genome ATCCAAATCC CTTTCTTCTT TTT ATT TTTTTTTCTT TTTTACTTGC AAAGTAGCAA AATCAACAAT 7156 G genome ATCCAAATCC CTTTCTTCTT TTT ATTTAT TTTTTTTCTT TTTTACTTGC AAAGTAGCAA AATCAACAAT 7140 Gossyp kirkii ATCCAAATCC CTTTCT CTT T TTTTTTTCTT TTTTACTTGC AAAGTAGCAA AATCAACAAT 7097 Kokia drynar ATCCAA C CTTTCT ATTT T TTTTTTTCTT TTTTACTTGC AAAGTAGCAA AATCAACAAT 7100 7220 7230 7240 7250 7260 7270 7280 A genome CAAAAGGGGC TTAAATAACT TTCTATGGGA TAGGATGAGA GCAATTCGAA TGGACCTGAG GATGCAGCAC 7180 B genome CAAAAGGGGC TTAAATAACT TTCTATGGGA TAGGATGAGA GCAATTCGAA TGGACCTGAG GATGCAGCAC 7226 C genome CAAAAGGGGC TTAAATAACT TTCTATGGGA TAGGATGAGA GCAATTCGAA TGGACCTGAG GATGCAGCAC 7167 D genome CAAAAGGGGC TTAAATAACT TTCTATGGGA TAGGATGAGA GCAATTCGAA TGGACCTGAG GATGCAGCAC 7174 E genome CAAAAGGGGC TTAAATAACT TTCTATGGGA TAGGATGAGA GCAATTCGAA TGGACCTGAG GATGCAGCAC 7227 F genome CAAAAGGGGC TTAAATAACT TTCTATGGGA TAGGATGAGA GCAATTCGAA TGGACCTGAG GATGCAGCAC 7226 G genome CAAAAGGGGC TTAAATAACT TTCTATGGGA TAGGATGAGA GCAATTCGAA TGGACCTGAG GATGCAGCAC 7210 Gossyp kirkii CAAAAGGGGC TTAAATAACT TTCTATGGGA TAGGATGACA GCAATTCGAA TGGACCTTAG GATGCAGCAC 7167 Kokia drynar CAAAAGGGGC TTAAATAACT TTCTATGGGA TAGGATGACA GCAATTCGAA TGGACCTTAG GATGCAGCAC 7170 7290 7300 7310 7320 7330 7340 7350 A genome ATCTTTGACC AAGGGGCAAT CACTATGCTA GAGCAAATGG TATGTCCTTG CAACTGGATC TTTCTTGTCG 7250 B genome ATCTTTGACC AAGGGGCAAT CACTATGCTA GAGCAAATGG TATGTCCTTG TAACTGGATC TTTCTTGTCG 7296 C genome ATCTTTGACC AAGGGGCAAT CACTATGCTA GAGCAAATGG TATGTCCTTG CAACTGGATC TTTCTTATCG 7237 D genome ATCTTTGACC AAGGGGCAAT CACTATGCTA GAGCAAATGG TATGTCCTTG CAACTGGATC TTTCTTGTCG 7244 E genome ATCTTTGACC AAGGGGCAAT CACTATGCTA GAGCAAATGG TGTGTCCTTG CAACTGGATC TTTCTTGTCG 7297 F genome ATCTTTGACC AAGGGGCAAT CACTATGCTA GAGCAAATGG TATGTCCTTG CAACTGGATC TTTCTTGTTG 7296 G genome ATCTTTGACC AAGGGGCAAT CACTATGCTA GAGCAAATGG TATGTCCTTG CAACTGGATC TTTCTTGTCG 7280 Gossyp kirkii ATCTTTGACC AAGGGGCTAT CACTATGCTA GAGCAAATGG TATGTCCTCG CAACTGGATC TTTCTTGTCG 7237 Kokia drynar ATCTTTGACC AAGGGGCTAT CACTATGCTA GAGCAAATGG TATGTCCTCG CAACTGGATC TTTCTTGTCG 7240 7360 7370 7380 7390 7400 7410 7420 A genome ATTGGCCCAT TATCTTGATT CTTGAATACT TGTGAATGTT GTGTAAAAAT TATCCCAACA AGTATTATTA 7320 B genome ATTGGCCCAT TATCTTGATT CTTGAATACT TGTGAATGTT GTGTAAAAAT CAACCCAACA ACTATTATTA 7366 C genome ATTGGCCCAT TATCTTGATT CTTGAATACT TGTGAATTTT GTGTAAAAAT CAACCCAACA AATATTATTA 7307 D genome ATTGGCCCAT TATCTTGATT CTTGAATACT TGTGAATGTT GTGTAAAAAT CAACCCAACA AATATTATTA 7314 E genome ATTGGCCCAT TATCTTGATT CTTGAATACT TGTGAATGTT GTGTAAAAAT CAACCCAACA AATATTATTA 7367 F genome ATTGGCCCAT TATCTTGATT CTTGAATACT TGTGAATGTA GTGTAAAAAT TATCCCAGCA AATATTATTA 7366 G genome ACTGGCCCAT TATCTTGATT CTTGAATACT TGTGAATGTT GTGTAAAAAT CAACCCAACA AATATTATTA 7350 Gossyp kirkii ATTGGCTCAT TATCTTGATT CTTGAATACT TGTGAATGTT GTGTAAAAAT CAACCCAACA AATATTCTCA 7307 Kokia drynar ATTGGCTCAT TATCTTGATT CTTGAATACT TGTGAAT TT GTGTAAAAAT CAACCCAACA AATATTCTCA 7310 7430 7440 7450 7460 7470 7480 7490 A genome GAAAAAGAAG TTCAGTTTCA TTTACATGGT CAGATAGAAG GTATTCCTAT TTATGCTGTG CTTGTGATTT 7390 B genome GAAAAAGAAG TTCATTTTCA TTTACATGGT CAGATAGAAG GTATTCCTAT TTATGCTGTG CTTGTGATTT 7436 C genome GAAAAAGAAG TTCATTTTCA TTTACATGGT CAGATAGAAG GTATTCCTAT TTATGCTGTG CTTTTGATTT 7377 D genome GAAAAAGAAG TCCATTTTCA TTTACATGGT CAGGTAGAAG TTATTCCTAT TTATGCCGTG CTTGTGATTT 7384 E genome GAAAAAG TTCATTTTCA TTTACATGGT CAGATAGAAG GTATTCCTAT TTATGCTGTG CTTCTGGTTT 7434 F genome GATAAAGAAG TTCATTTTCA TTTACATGGT CAGATAGAAG GTATTCCTAT TTATGCTGTG CTTGTGATTT 7436 G genome GAAAAAG TTCATTTTCA TTTGCATGGT CAGATAGAAG GTATTCCTAT TTATGCTGTG CTTTTGATTT 7417 Gossyp kirkii GAAAAAAAAG TTATTCCTAT TTATGCTGTG CTTGTGATTT 7347 Kokia drynar GAAAAAAAAG TTATTCCTGT TTATGCTGTG CTTGTGATTT 7350 7500 7510 7520 7530 7540 7550 7560 A genome TAATTATATG TAGAATGAAC TGATAAACAT AGCTGTTTTT TGGTCTTGCC TACATTTTTG TTCATCATTG 7460 B genome TAATTATATT TAGAATGAAC TGATAAACAT AGCTGTTTTT TGGTCTTGCC TACATTTTTG TTCATCATTG 7506 C genome TAATTATATT TAGAATGAAC TGATAAACAT AGCTGTTTTT TGGTCTTGCC TACATTTTTG TTCATCATTG 7447 D genome TAATTATATT TAGAATGAAC TGATAAACAT AGCTGTTTTT TGGTCTTGCC TACATTTTTG TTCATCATTG 7454 E genome TAATTATATT TAGAATGAAC TGATAAACAT AGCTGTTTTT TGGTCTTGCC TACATTTTTT TTCATCATTG 7504 F genome TAATTATATT TAGAATGAAC TGATAAACAT AGCTGTTTTT TGGTCTTGCC TACATTTTTG TTCATCATTG 7506 G genome TAATTATATT TAGAATGAAC TGATAAACGT AGCTGTTTTT TGGTCTTGCC TACATTTTTG TTCATCATTG 7487 Gossyp kirkii TAATTATATT TAGAATGAAC TGATAAACAT AGTTGTTTTT TTATCTTGCC TACATTTTTG TTCATCATTG 7417 Kokia drynar TAATTATATT TAGAATGAAC TGATAAACAT AGCTGTTTTT TTATCTTGCC TACATTTTTG TTCATCATTG 7420 7570 7580 7590 7600 7610 7620 7630 A genome TTTTGCTCCA TAAGTCATAA CGTATTGCAT TTGGGGACAA ATATCTAAAT CATTGCTATG ATTTGTTCAA 7530 B genome TTTTGCTCCA TAAGTCATAA TGTATTGCAT TTGGGGACAA ATATCTAAAT CATTGCTATG ATTTGTTCAA 7576 C genome TTTTGCTCCA TAAGTCATAA TGTATTGCAT TTGGGGACAA ATATCTAAAT CATTGCTATG ATTTGTTCAA 7517 D genome TTTTGCTCCA TAAGTCATAA TGTCTTGCAT TTGGGGACAA ATATCTAAAT CATTGCTATG ATTTGTTCAA 7524 E genome TTTTGCTCCA TAAGTCATAA TGTATTGCAT CTGGGGACAA ATATCTAAAT GATTGCTATG ATTTGTTCAA 7574 F genome TTTTGCTCCA TAAGTCATAA TGTATTGCAT TTGGGGACAA ATATCTAAAT CATTGCCATG ATTTGTTCAA 7576 G genome TTTTGCTCCA TAAGTCATAA TGTATTGCAT TTGGGGACAA ATATCTAAAT CATTGCTATG ATTTGTTCAA 7557 Gossyp kirkii TTTTGCTCCA TAAGTCATAA TGTATTGCAT TTGGGGACAA ATATCTAAAT CATTGCTATG ATTTGTTCAA 7487 Kokia drynar TTTTGCTCCA TAAGTCATAA TGTATTGCAT TTGGGGACAA ATATCTAAAT CATTGCTATG ATTTGTTCAA 7490 7640 7650 7660 7670 7680 7690 7700 A genome TTAGTGGTGC TGATTGCTGT TTTTGTCAGA TAAGGCTTCA CATAATTGCC ATGCATGAAT TATGTGAATA 7600 B genome TTAGTGGTGC TGATTGCTGT TTTTGTCAGA TAAGGCTTCA CATAATTGCC ATGCATGAAT TATGTGAATA 7646 C genome TTAGTGGTGC TGATTGCTGT TTTTGTCAGA TAAGGCTTCA CATAATTGCC ATGCATGAAT TATGTGAATA 7587 D genome TTAGTGGTGC TGATTGCTGT TTTTGTCAGA TAAGGCTTCA CATAATTGCC ATGCATGAAT TATGTGAATA 7594 E genome TTAGTGGTGC TGATTGCTGT TTTTGTCAGA TAAGGCTTCA CATAATTGCC ATGCATGAAT TATGTGAATA 7644 F genome TTAGTGGTGC TGATTGCTGT TTTTGTCAGA TAAGACTTCA CATAATTGCC ATGCATGAAT TATGTGAATA 7646 G genome TTAGTGGTGC TGATTGCTGT TTTTGTCAGA TAAGGCTTCA CATAATTGCC ATGCATGAAT TATGTGAATA 7627 Gossyp kirkii TTAGTAGTGC TGATTGCTGT TTTTGTCAGA TAAGGCTTCA CATAATTGCC ATGCATGAAT TATGTGAATA 7557 Kokia drynar TTAGTAGTGC TAATTGCTGT TTTTGTCAGA TAAGGCTTCA CATAATTGCC ATGCATGAAT TATGTGAATA 7560 7710 7720 7730 7740 7750 7760 7770 A genome CACCAAAGGC GAGGGCTTCT CTGAGGGATT TGATGCACAT CTAAATATCG AGCAGATGAA CAAAACATCA 7670 B genome CACCAAAGGC GAGGGCTTCT CTGAGGGATT TGATGCACAT CTAAATATCG AGCAGATGAA CAAAACATCA 7716 C genome CACCAAAGGC GAGGGCTTCT CTGAGGGATT TGATGCACAT CTAAATATTG AGCAGATGAA CAAAACATCA 7657 D genome CACCAAAGGC GAGGGCTTCT CTGAGGGATT TGATGCACAT CTAAACATCG AGCAGATGAA CAAAACATCA 7664 E genome CACCAAAGGC GAGGGCTTCT CTGAGGGATT TGATGCACAT CTAAATATCG AGCAGATGAA CAAAACATCA 7714 F genome CACCAAAGGC GAGGGCTTCT CTGAGGGATT TGATGCACAT CTAAATATCG AGCAGATGAA CAAAACTTCA 7716 G genome CACCAAGGGC GAGGGCTTCT CTGAGGGATT TGATGCACAT CTAAATATTG AGCAGATGAA CAAAACATCA 7697 Gossyp kirkii CACCAAAGGC GAGGGCTTCT CTGAGGGATT TGATGCACAT CTAAATATCG AGCAGATGAA CAAAACATCA 7627 Kokia drynar CACCAAAGGC GAGGGCTTCT CCGAGGGATT TGATGCACAT CTAAATATCG AGCAGATGAA CAAAACATCA 7630 7780 7790 7800 7810 7820 7830 7840 A genome GTTGAGCTAT TCCAAATGTA TGATGATCAC AGGAAGAAAG GAATTAATGT TTCAACAGAA AAGGAGTTCA 7740 B genome

    Original URL path: http://ajbsupp.botany.org/v89/cronn-nu.txt (2016-02-14)
    Open archived version from archive


  • L trichandra 53 88L trichandra 128 92L trichandra 137 92 CCGATGCCCCGCGACAA GAGCGACCCGTGAAC CGGTTGGCATAAGCACCGGGCGGGGGGCGCCCC AGGCGTCCTCCCCCGCGCG CCGTGGGCGCGGC AGCCCTCGGCCCCAACAA CCAATCCCGGCGCCGCAGGCGCCAAGGAAGAGCAAC GAA GCGAGCACGCCGCTGGGC GGCCCGGGAACGGCGCCGGTGACCCAGCGTCGCGTCTCATGACATTTGCATCCGAAA CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCAACGTCGCCACMGCCCCTCCC CGGGGCGCGGCGGAGGATGGCTTCCCGGGAGCCCCGTCTCCCGGCCTGCCGAAAAAGGGGCCCAACGTGGCGACCGCCACGATCCACGGTGGATGAGTGAGCTG CGCGCGCT CGAGGCCA GGCGTGAGCGCGTCRTGCCACGG CA GGGTCCGGC TCCYTGGGCCTCCGGGAGGAGCGCCCAAGACTCGTAC GGAAAG AAAAAGAAAAAAGAGGGGGAAAAG AACCAACCCAAAAAGGAACACAGCCCCAAAACAAAAAAAAAAAAAAAAA AAAAAAAMAAAAAAAAAAAAAAAAAMAAAAAAAAAAMAAMAAAAAAAAACAAAAAAAAAAAAAAAAAAAMAAAAAAAAAAAAAAAACAAAAACACAAAA AAAA L trichodes 61 88L trichodestris2 86tris62 86 CCGATGCCCCTCGACAA GAGCGACCCGTGAAC CGGTTGGAAGAAGCACCGGGCGGGTGGCGCCCC AGGCGTCCCCTCCCGCKCG CCGWGGGCGCGGA AGCCCTCGGCCCCAACAA CCAATCCCGGCGCCGCAGGCGCCAAGGAAGAGCAAC GAA GCGAGCACGCCGCTGGGC GGCCCGGGAACGGCGCCGGTGTCCCAGCGTCGCGTCTCATGACATTCGCATCCAAAA CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCAACGTCGCCACCGCCCCTCCA CGGGGCGCGGCGGAGGATGGCTTCCCGGGAGCCCCGTCTCCCGGCCTGCCGAAAAAGGGGCCCAACGTGGCGACCGCCACGATCCACGGTGGATGAGTGAGCCG CGCGCGCT CGAGGCCA GGCGTGAGCGCGTCGTGCCACGG CA GGGTCCGGC TCCYTGGGCCTCCGGCAGGAGCGCCCAAGACTCGTAC GGAAAG AAAAAGAAAAAAGAGGGGGAAAAG AACCCCGCCCAAAAAGAACGAGGCCCCAAMACMAAAAAAAAAAAAAAAAAAMAAACAAAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACACAAAACACAAAAAAAAAAAA L retusa 23 86L retusaret23 86 TCGATGCCCCGCAACAA GAGTGACCCGCGAAC CGGTTGGCAGAAGCACCGGGCG CCGTGGGCGCGGCCTGCGCTGACGCGGAGGCCCAGCCCCCGGCCCCGACAA CCAATCCCGGCGCCGCAGGCGCCAAGGAAGAGCAAC GAA GCGAGCGCGCCGCTGGAC GGCCCGGGAACGGTGCCGGCGGCCCAGCGCTGCGTCTCATGACATTTGCA CCGAAAACGACTCTCGGCAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACGCCATTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCAGCGTCGCCGCCGCCCGTCCC ACGGGCGCGGCGGATGATGGCTTCCCGGGAGCCCCGTCTCCCGGCCTGCCGAAAATGGGGCCCAACGTGGCGACCGCCGCGATCCACGGTGGATGAGTGAGCCA CAGGCGCT CGAGGCCA GGCGTGAGCGCGTCGCGGCACGGTATA GGGGCCGGCAT GCGGGGCGTCCTGCAGGAGCGCCCCAGACTCGTAC GGA A AA AAAAAAAAGAGGAGAAGAAG A CCCCACAAAAACCGACACCAGCACCCCAACACACCCCAAAAAAAAAACACACAAAACAACAAAACACACAAAAACAAACAACAACAAAACAAAAAACCAAAA ACAAAAAAACAAAAAAAAAACAAAAAAAAAAACAAAAAAAAACACAAACAAAAAAAC L greggii 82 87L greggiigre32 87 TCGATGCCCCGCAACAA GAGTGACCCGCGAAC CGGTTGGCAGAAGCACCGGGCGGGGGGCC GCCCCCGACCCCAACAA CCAATCCCGGCGCCGCAGGCGCCAAGGAAGAGCAAC GAA GCGAGCGCGCCGCTGGAC GGCCCGGGAACGGTGCCGGTGACCCAGCGTCGCGTCTTAWGGCATTTGCCACCAAAA CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCAACGTCGCCACCGCCCATCCC ACGGGCGCGGCGGATGATGGCTTCCCGGGAGCCCCGTCTCCCGGCCTGCCGAAAAAGGGGCCCAACGTGGCGACCGCCACGATCCACGGTGGATGAGTGAGCTA CAGGCGCT CGAGGCCA GGCGTGAGCGCGTCGTGCCACGGTACAAGGGGCCGGCAT GCGGGGCCTCCTGCAGGAGCGCCCCAGACTCGTAC GGAAA A AAAAAAGAGGAAAAGAAG AACCAAACAAAAACCGACAACAGCACCCCACCAAACCAAAAACAAAAAAACAAACAAACAACA AAAACACAAACACAAACAAAAA A AAAAACCAAAA ACAAAAAAAAAACAAAAAAAAAACAAAAAAACCAAACAAAAACACAAACAAAACCAC L lanceolata ssp sousae 50 87L lanceolatasou50 87sou51 87 CCGATGCCCCGCAACAA GAGCGACCCGTGAAC CGGTTGGCAGAAGCWCCGGGCGGGTGGCGCCCC AGGCGTCCCCCCCCGCGCG CCGTGGGCGCGGN AGCCYTCGGCCCCAACAA CCAATCCCGGCGCCGCAGGCGCCAAGGAAGAGCAAC GAA GCGAGCACGCCGTTGGGC GGCCCGGGAACGGCGCCGGTGACCCAGCGTCGCGTCTCATGACATTTGCATCCGAAA CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCAACGTCGCCACCGCCCCTCCA CGGGGCGCGGCGGAGGATGGCTTCCCGGGAGCACCGTCTCCCGGCCTGCCGAAAAAGGGGCCCAACGTGGCGACCGCCACGATCCACGGTGGATGAGTGAGCTG CGCGCGCT CGAGGCCA GGCGTGAGCGCGTCGTGCCACGG CA GGGTCCGGC TCCCTGGGCCTCCGGCAGGAGCGCCCAAGACTCGTAC GGAAAG AAAAAGAAAAAAGAGGGGGAAAAG AACCCCGCCCAAAAAGAACACAGCCCCAACACAAAAAAAAAAAAAAAAAAACAACAAAAAAAACAAAAAAAAAAACAAAAAAAAAAAAAAAAAACAAAAAAAAA AAAAAAAAAAMAAAAAAAAAACAAAAAAAAAAAAAACAAAAACACAAAAAACAAAAA L esculenta 47 87L esculentaesc47 87esc48 87 CCGATGCCCCGCGAAAAAGAGAGACCCGCGAAC CGGTTGGCACAAGCACCGGGCGGGGGGA CGGCCGCGGC GCCCCCGGCCCCAACAA CCAATCCCGGCGCCGCAGGCGCCAAGGAAGAGCAAC GAA GCGAGCACGCCGCTGGAC GGCCCGGGAACGGCGCCGGTGACCCAGCGTCGCGTCTCATGACATTTGCATCCGAAA CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCAACGTCGCCGCCGCCCGTCCC GCGGGCGCGGCGGATGATGGCTTCCCGGGAGCCCCGTCTCCCGGCCTGCCGAAAAAGGGGCCCAACGTGGCGACCGCCACGATCCACGGTGGATGAGTGAGCTAACACGCGCT CGAGGCCA GGCGTGAGCGCGTCGATCCACGG CA GGGTCCGGCCTCCG GCCC AGACTCGTAC AGAAG AA G AAAAAAGAAGGGAAAGGG CCCCAACCCCCAAAAGAACACAGCCCCAAAAMAAACAAAAAAAACAAAA AAACAAAAAAAAAAAAAAAAAAAAAACAAAAAAACAAAAAAACCAACACAMACACAAAAAAAAAAACAAAAAAAAAAACAAAAAAACAAAAACACCAAA AAAC L pueblana 125 92L pueblanapue125 92pue34 89 CCGATGCCCCGCGACAAAGAGAGACCCGCGAAC CGGTTGGCACAAGCACCGGGCGGGGGGA CGGCCGCGGC GCCCCCG CCCCAACAA CCAATCCCGGCGCCGCAGGCGCCAAGGAAGAGCAAC GAA GCGAGCACGCCGCTGGAC GGCCCGGGAACGGCGCCGGTGACCCAGCGTCGCGTCTCATGACATTTGCATCCGAAA CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCAACGTCGCCGCCGCCCGTCCC GCGGGCGCGGCGGATGATGGCTTCCCGGGAGCCCCGTCTCCCGGCCTGCCGAAAAAGGGGCCCAACGTGGCGACCGCCACGATCCACGGTGGATGAGTGAGCTAACACGCGCT CGAGGCCA GGCGTGAGCGCGTCGATCCACGG CA GGGTCCGGCCTCCG GCCC AGACTCGTAC AGAAG AA G AAAAAAGAAGGGAAAGGG CCCCAACCCCAAAAAGAACACAGAACCAAAACAAACAAAAAAAAACAAA AAACAAAAAAAAAAAAAAAAAAAAAACAAAAAAACAAAAAAACCAACCAACACACAAAAAAAAAAACAAAAAAAAAAACAAAAAAACAAAAACACCAAA AAAC L matudae 49 87L matudaemat49 87 CCGATGCCCCGCGACAAAGAGAGACCCGCGAAC CGGTTGGCACAAGCACCGGGCGGGGGGA CGGCCGCGGC GCCCCCGGCCCCAACAA CCAATCCCGGCGCCGCAGGCGCCAAGGAAGAGCAAC GAA GCGAGCACGCCGCTGGAC GGCCCGGGAACGGCGCCGGTGACCCAGCGTCGCGTCTCATGACATTTGCATCCGAAA CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGRGGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCAACGTCGCCGCCGCCCGTCCC GCGGGCGCGGCGGATGATGGCTTCCCGGGAGCCCCGTCTCCCGGCCTGCCGAAAAAGGGGCCCAACGTGGCGACCGCCACGATCCACGGTGGATGAGTGAGCTAACACGCGCT CGAGGCCA GGMGTGAGCGCGTCGATCCACGG CA GGGTCCGGCCTCCG GCCC AGACTCGTAC AGAAG AA G AAAAAAGAAGGGAAAGGG ACCCAAACACAAAAAGAACACAGCCAACCAACAAAAAAAAAAAACAAAA AACAAAAAAAAAAAAAAAAAAAAAAACAAA AAAAACCAAACAAAACAACAAAAAAAAAACAAAAAAAAACAACAAAAAAAAAAAACACCAAA AAAC L pulverulenta 1593 R1its4L pulverulenta 84 87 TCGATGCCCCGYAACAV GWGTGAYCCRYRAAC YGGTTGRCAGAAGCACYRGGCGGGGGVCCGMCG KAKGYGCCCTCMCCYGCGCR YYGYGGRYGCRGCCTRYGCTGAMGYRGAGGCCCAKCCCCARGHCCCAACAA CCARTCCYRGCRYCGYAGRCGCCARGGAAGAGCAAC GAA GMGAGCRMGMCGCTGGAY GGCCCGGGAACGGCGCYGGTGACCYAGCRTYGCRTCYTATGACATTTGCATCCRAAA YRACTCYCGRCAAYGGATATCTCGGYTCTCRCATCGATGAAGAAYGTAGYGAAATGYGATACTTGGTGTGAATTRCMRAATCCCGTGAACCATCGWGTCTTTGAACKYAAGTTGCGCCCGACGCCATTAGGCCGAGGGMACGTCTRCCTRGGTRTCAYGCRRCRTCGCCAYCGCCYWTCCCCABGGGHGCGGYKGATGATGGCTTCCYGGGAGCCYYGTCTCCYGGCCTGCCRAAARAGGGGCCCAACGTGGSGACCGYCACGAWCCAYGGTGGATGAGTGAGCYA YAAGCRCT CGAGNCCAAGGMGTGAGCSMGTCGTDCCGCRGTGYAAGGSSCSGGCWT GYCC AGANCCGTAS GGAAARGAAAAAARRAAAARAGAAAAG GG AACCAAGCCAAAACAAACACCAGCCCCACAAAAAACAAAAAACCAAAAA AACACACAAAAACAAAAAAAAAAAAACACACAAAAAAAAAAACACACCAACACACACCAAAAACACAACAAAAAACAAAAAAAAAAAAACCAAAAAAAC AAAC L lanceolata 913 Q1its4L lanceolata ssp lanceolata 44 85 CCGATGCCCCGCRACAA GAGCGACCCGTGAAC CGGTTGGCAKAAGCACMGGGCGGGKGGCGCCCC AGGCGTCCYCCCCCGCGCG CCGTGGGCGCKGC AGCCCTCGGCCCCAACAA CCAATCCCGGCGCCGCAGGCGCCAAGGAAGAGCAAC GAA GCGAGCRCGCCGCTGGGC GGCCCGGGAACGGCGCCGGTGACCCAGCGTCGCGTCTCATGACATTTGCATCCGAAA CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCAACGTCGCCACCGCCCCTCCM CGGGGCGCGGCGGAGGATGGCTTCCCGGGAGCMCCGTCTCCCGGCCTGCCGAAAAAGGGGCCCAACGTGGCGACCGCCACGATCCACGGTGGATGAGTGAGCTG CGCGCGCT CGAGGCCA GGCGTGAGCGCGTCGTGCCACGG CA GGGTCCGKC TCCBTGGGCCTCCGGCAGGAGCGCCCAAGACTCGTAC GGAAAG AAAAAGAAAAAAGAGGGGGAAAAG AACCCCGCCCAAAAAGAACACAGCCCCAAAACAACAAAAMAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAMAAAAACAAAAMMAAAAAACAAAAAAAAAACAAAAAAAAAAMAAAAAAAAAAAAAAAAAAAAAAAAAMMAAAACACAAAAMMAAAAAA L shannonii 135 92L shannonii 141 92L shannonii 1 91 CCGATGCCCCGCGACAA GAGCGACCCGTGAAC CGGTTGGCATRAGCACCGGGCGGGGGGCGCCCC AGGCGTCCTCCCCCGCGCG CCGTGGGCGCGGC AGCCCTCGGCCCCAACAA CCAATCCCGGCGCCGCAGGCGCCAAGGAAGAGCAAC GAA GCGAGCACGCCGCTGGGC GGCCCGGGAACGGCGCCGGTGWCCCAGCGTCGCGTCTCATGRCATTTGCATCCGAAA YGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATTAGGCCGAGGGCACGYCTGCCTGGGTGTCACGCAACGTCGCCMCCGCCCCTCCC SGGGGCGCGGCGGAGGATGGCTTCCCGGGAGCCCCGTCTCCCGGCCTGCCGAAAAAGGGGCCCAACGTGGCGACCGCCACGATCCACGGTGGATGAGTGAGCTG CGCGCGCT CGAGGCCA GGCGTGAGCGYGTCGTGCCACGG CA GGGTCCGGC TCCSTGGGCCTCCGGCAGGAGCGCCCAAGACTCGTAC GGAAAG AAAAAGAAAAAAGAGGGGGAAAAG AACCACGCCCAAAAAGAGCACAGCCCCAAAACAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAMAAAAAAAAAAAAAAAAAAAAAAAMAAAACAAAAAAAAAAAACAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAACAAAAACACAAAACAAAAAAA cc 0 873 cc 1 9 11 15 20 22 27 29 61 63 66 77 81 85 99 101 102 104 106 111 113 118 120 121 123 148 150 153 155 196 198 214 216 224 226 236 238 241 243 245 247 258 260 262 264 265 267 270 272 281 284 407 409 411 413 415 455 457 462 466 468 471 475 477 482 484 537 539 546 548 570 573 574 577 587 589 590 592 593 595 598 600 607 610 614 616 617 619 621 623 625 627 629 632 636 643 647 656 659 661 663 670 672 674 677 681 684 688 690 691 693 697 702 707 710 715 719 720 734 738 742 745 749 751 753 756 758 760 761 764 765 770 774 775 779 781 783 785 787 789 791 793 795 797 799 801 803 805 808 809 812 817 819 821 823 829 831 832 834 841 843 845 847 849 852 855 857 858 861

    Original URL path: http://ajbsupp.botany.org/v89/hughes-matrix1.txt (2016-02-14)
    Open archived version from archive


  • 4 001001000010000000000000000000000010000000000010000010000100000001000000000 000000000010000000000000000000000000010000101000001000000 L lanceolata var lanceolata 1 001 00000000000000 000000010000000000010000010000000000001000000000010000000000000000000000000000000 00001000001010000 0000 L lanceolata var sousae 2 101000000000000000000010010000000010000000000010000000000 00000001000000000 000000000010000000000100000000000000100000101000000100000 L lanceolata var sousae 1 10100000000000000000001001000 00 0 0000000000010000000000000000001000000000 000000000000000000000100000000000000100000101000000100000 L lempirana 1 101 00000000000000 000000000000000000000000000000000000000000000000010000000000000000000000000000000 00001000001010000 0000 L lempirana 2 101 00000000000000 000000000000000000000000000000000000010000000000010000000000000000000000000000000 00001000001010000 0000 L leucocephala ssp gla 1 2 4 5 7 8 13 leuco 1 4 000 10000001100000 00101010000010000000000000101010000 00010101100101100110000010100100000010000000000000110 001 0001 L leuco ssp glab 3 6 9 10 11 12 15 17 ixtah 2 leuco 2 3 000 10000001100000 001010100000100000000000001010100000100000101011001011001100000101001000000100000 00000001100000001 0001 L leucocephala ssp ixtahuacana 1 000 10000001100001 1110100000011000000000 001101011 101100 0000010 10000001000000000 001 L macrophylla ssp macrophylla 1 000000 000000001100010010000000000000000000000000000000 000000001000000000000000000000000000010000101000000010000 L macrophylla ssp istmensis 1 001100000000000000000000001000000011100010010000000000000001000000000000000 000000001010000000000000000000000000010000101000010000000 L macrophylla ssp istmensis 2 001100000000000000000000001000000001100010010000000000000001000000000000000 000000001010000000000000000000000000010000101000010000000 L magnifica 2 001000000000000000000000010000000010000000000000000000000100000100000000000 000000000001000000010000000000000000100000101000010000000 L magnifica 1 001000000000000000000000010000000010000000000000000000000010000100000000000 000000000001000000010000000000000000100000101000010000000 L matudae 00100000000000010000 001000000000000000000000001000 00000110001000010010000000000100000000010010000000000001011000 0001 L multicapitula 2 0010000000010000000000100010000000 0000000100000000000000 00000000000000 000000000010000000000010000000000000000001101000000010010 L multicapitula 1 001000000000100000000001001000000010000000100000000000000 00000000000000 000000000000000000100000000000000000000001101000000010010 L pallida 2 4 001 10000000001000 00010000000000000000000000100000001 00011001100001010000000000010000000000010000000100000 000 0001 L pallida 3 001 10000000001000 00010000000000000000000000000000001 00011001100001010000000000010000000000010000000100000 000 0001 L pallida 1 001 10000000001000 000100000000000000000000001000000010000000110011000010100000000000100000000000100 00001000001011000 0001 L pueblana 2 00100010000000001000 000100000000000000000000001000000010000000110011001010100000000000100000000000100000001000001011000 0001 L pueblana 1 001 10000000001000 000100000000000000000000001000000010000000110011001010100000000000100000000000100000001000001011000 0001 L pulverulenta 2 4 6 00000010000001100000 001010100000100000000000001010100000000000101011001010101100000101001000000100000000000001100000001 0001 L retusa 001010111100000000001010100001001000010101000001000100100100001000000110000 010000000100000000001000000000001000000000101000100000001 L salvadorensis 4 001 00001000000000 000000000000001000000100000000000000001010000000010000000000000000000000000000000 00001000001010000 0000 L salvadorensis 3 001000000010000000000010000000000010000000100000100000000 00001000000000 000000000000000000000000000000000000100000101000000010010 L salvadorensis 1 001000000010000000000010000000000000000000100000100000000 00001000000000 000000000000000000000000000000000000100000101000000010010 L salvadorensis 2 001 00001000000000 000000000000001000000100000000000000001000000000010000000000000000000000000000000 00001000001010000 0000 L salvadorensis 5 001 00001000000000 000000000000001000000100000000000000001010000000010000000000000000000000000000000 00011000001010000 0000 L shannonii 2 3 5 6 001 00000000000000 000000010000000000000000000000000000100000000000010000000000000000000100000000000 00001000001010000 0000 L shannonii 1 001000000000000000001000000000000000000000000000000000000010000100000000000 000000000000000000010000000000000000100000101000010000000 L trichandra 3 001 00000000000000 00000000000000000000000000000000000 00000000001000000000000000000010000000000000000100000 000 0000 L trichandra 1 2 6 001 00000000000000 00000000000000000000000000000000000 00000000001000000000000000000000000000000000000100000 000 0000 L trichandra 8 12 001 00000000000000 000000000000000000000000000000000000000000000000010000000000000000000100000000000 00001000001010000 0000 L trichandra 7 001 00000000000000 000000000000000000000000010000000000000100000000010000000000000000000000000000000 00001000001010000 0000 L trichodes 1 101000000000000000000010001000000010000000000000000000000 00000000000010 000000000000000000000000000000000001010000101000000000000

    Original URL path: http://ajbsupp.botany.org/v89/hughes-matrix2.txt (2016-02-14)
    Open archived version from archive


  • A AAAGAAAGAAAAAGAGAGGGAGGAAAA L confertiflora var confertiflora 1c CCGATGCCCCGCGACAA GAGCGACCCGTGAAC CGGTTGGCATAAGCACCGGGCGGGGGGCGCCCC AGGCGTCCTCCCCCGCGTG CCGTGGGCGCGGT AGCCCTCGGCCCCAACAA CCAATCCCGGCGCCGCAGGCGCCAAGGAAGAGCAAC GAA GCGAGCGCGCTGCTGGGC GGCCCGGG AACGGCGCCGATGACCCAGCGTC GCGTCTCATGACATTTGCATCCGAAA CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCAACGTCGCCACCGCCCCTCCC CGGGGCGCGGCGGAGGATGGCTTCC CGGGAGCCCCGTCTCCCGGCCTGCCGAAAAAGGGGCCCAACGTGGCGACCGCCACGATCCACGGTGGATGAGTGAGCTG CGCGCGCT CGAGGCCA GGCGTGAGCGCGTCGTGCCACRA CA GGGTCCGGC TCCCTGGGCCTCCGGGAGGAGCGCCCAAGACTCGTACGGAAAAG A AAAGAAAGAAAAAGAGAGGGAGGAAAA L involucrata 1b TTGATGCCTTGCGACAA GAGTGACCCGTGAAC CGGTTGGTAGAAGCACCGGGTGGGGG CACCCC AAGCGTCCTCTCCCGCGC ACAGGCGCCAAGGAAGAGCAAC GAA GCGAGCATACCGCTGG ACAATGGATATCTCAGCTCTCACATCGATGAAGAACGTAGTGAAATACGATACTTGGTGTGAATTGTAGAATCCCATGAATCATCGAGTCTTTGAATGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGAACGTCTGCTTGGGTGTCACGCAACGTCGCCACCGCCCCTCCC TGGGGCACGGCGGAGGATGGCTTCC AGGGAGCCCCATCTCTTAGCCTGCCGAAAAAAGGGCCCAACGTGGCGACCGCCACGATCCACGGTGGATGAGTGAGCTA CACGCGCT CGAGGCCA GGCGTG GCGAATCATGCCACGG CA GGGTCCGGC TCCCTGGGCCTCCGGCAGGAGCGCCCAAGACTAGTACGGAAGAG A AAGA AAG AGAGGGAGGAAAA L pallida 2b CTGATGCCCTGCGACAA GAGTGACCCGTGAAC CGGTTGGCAGAAGCACTGGGTGGGGGGCACCCC AGGCGTCCTCTCCCGCGC ACAGGCGCCAAGGAAGAGCAAC GAA GCGAGCATGCCACTGG ACAATGGATATCTCGGCTCTCACATCGATGAAGAACGTAGTGAAATACGATACTTGGTGTGAATTGTAGAATCCCATGAATCATCGAGTCTTTGAATGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGTCTGCTTGGGTGTCACGCAACATCGCCGCCGCCCGTCCC GCGGGCGCGGCGGATGATGGCTTCC CGGGAGCCCCGTCTCCCGGCCTGCCGAAAAAGGGGCCCAACGTGGCGACCGCCACGATCCACGGTGGATGAGTGAGCTAACACGCGCT CGAGGCCA GGCGTGAGCGCGTCGATCCACGG CA GGGTCCGGCCTCCG GCCC AGACTCGTACGGAAAAG A AAGA AAG AGAAGGAGAAAGG L pallida 4b CTGATGCCCTGTGACAA GAGTGACCCGTGAAC CGGTTGGCAGAAGTACCGGGTGGGGGGCACCCC AGGCGTCCTCTCCCGTGC ACAGGTGCCAAGGAAGAGCAAC GAA GCGAGCATGCCGCTGG ACAATGGATATCTCGGCTCTCACATCGATGAAGAACGTAGTGAAATACGATACTTGGTGTGAATTGTAGAATCCCATGAATCATCGAGTCTTTGAATGCAAGTTGCACCCGAAGCCATTAGGCTGAGGGCACGTCTGCTTGGGTGTCACGCAACGTCGCCACCGCCCCTCCC CGGGGCACGGCGGAGGATGGCTTCC AGGGAGCCCTATCTCCCGGCCTGCCGAAAAAGGGGCCCAACGTGGCGACCGCCACGGTCCACGGTGGATGAGTGAGCTAACACGCGCT CGAGGCCA GGCGTGAGCGCGTCGATCCACGG CA GGGTCCGGCCTCCG GCCC AGACTCGTACGGAAAAG A AAGAA AAG AGAAGGAGAAAGG L leucocephala ssp ixtahuacana 2b CCGATGCCCCGCGACAA GAGCGACCCGTGAAC CGGTTGGCAGAAGCACCGGGCGGGTGGCGCCCC AGGCGTCCCCCCCCGCGCG CCGTGGGCGCGGC AGCCCTCGGCCCCAACAA CCAATCCCGGCGCCGCAGGCGCCAAGGAAGAGCAAC GAA GCGAGCACGCCGCTGGGC GGCCCGGG AACGGCGCCGGTGACCCAGCGTC GCGTCTCATGACATTTGCATCCGAAA CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCAACGTCGCCACCGCCCCTCCA CGGGGCGCGGCGGAGGATGGCTTCC CGGGAGCACCGTCTCCCGGCCTGCCGAAAAAGGGGCCCAACGTGGCGACCGCCACGATCCACGGTGGATGAGTGAGCTG CGCGCGCT CGAGGCCA GGCGTGAGCGCGTCGTGCCACGG CA GGGTCCGGC TCCCTGGGCCTCCGGCAGGAGCGCCCAAGACTCGTACGGAAAAG A AAAGAAAGAAAAAGAGAGGGAGGAAAA L leucocephala ixta 1a TCGATGCCCCGCAACAA GAGTGACCCGCGAAC CGGTTGGCAGAAGCACCGGGCGGGGGGCCGACG AGGCGCCCTCCCCCGCGCG CCGCGGGCGCGACCTGCGCTGACGCGGAGGCCCAGCCCC GGCCCCAACAA CCAATCCCGGCGCCGCAGGCGCCAAGGAAGAGCAAC GAA GCGAGCGCGCCGCTGGAC GGCCCGGG AACGGCGCCGGTGACCCAGCGTC GCGTCCTATGACATTTGCATCCGAAA CGACTCCCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCAGCGTCGCCACCGCCCTTCCCCAGGGGCGCGGCGGATGATGGCTTCC CGGGAGCCCCGTCTCCCGGCCTGCCGAAAGAGGGGCCCAACGTGGCGACCGCCACGAACCACGGTGGATGAGTGAGCTA CAAGCGCT CGAGGCCAAGGCGTGAGCGCGTCGTGCCGCGGTGCAAGGGCCCGGCAT GCCC AGACCCGTACGGAAAAG A AAAAAGAGAAAAAGAAAGAAAAAG G L pulverulenta 3a TCGATGCCCCGCAACAG GAGTGACCCGCGAAC CGGTTGGCAGAAGCACCGGGCGGGGGGCCGACG AGGCGCCCTCCCCCGCGCG TCGCGGGCGCGGCCTGCGCTGACGCGGAGGCCCAGCCCC GGCCCCAACAA CCAATCCCGGCGCCGCAGGCGCCAAGGAAGAGCAAC GAA GCGAGCGCGCCGCTGGAC GGCCCGGG AACGGCGCCGGTGACCCAGCGTC GCGTCCTATGACATTTGCATCCGAAA CGACTCCCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCAGCGTCGCCACCGCCCTTCCCCAGGGGCGCGGCGGATGATGGCTTCC CGGGAGCCCCGTCTCCCGGCCTGCCGAAAGAGGGGCCCAACGTGGCGACCGCCACGAACCACGGTGGATGAGTGAGCTA CAAGCGCT CGAGNCCAAGGCGTGAGCGCGTCGTGCCGCGGTGCAAGGGCCCGGCAT GCCC AGANCCGTACGGAAAAG A AAAAAGAGAAAAAGAAAGAAAAAG G L pulverulenta 6 TCGATGCCCCGCAACAA GAGTGACCCGCGAAC CGGTTGGCAGAAGCACCGGGCGGGGGGCCGACG AGGCGCCCTCCCCCGCGCG CCGCGGGCGCGGCCTGCGCTGACGCGGAGGCCCAGCCCC GGCCCCAACAA CCAATCCCGGCGCCGCAGGCGCCAAGGAAGAGCAAC GAA GCGAGCGCGCCGCTGGAC GGCCCGGG AACGGCGCCGGTGACCCAGCGTC GCGTCCTATGACATTTGCATCCGAAA CGACTCCCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCAGCGTCGCCACCGCCCTTCCCCAGGGGCGCGGCGGATGATGGCTTCC CGGGAGCCCCGTCTCCCGGCCTGCCGAAAGAGGGGCCCAACGTGGCGACCGCCACGAACCACGGTGGATGAGTGAGCTA CAAGCGCT CGAGGCCAAGGCGTGAGCGCGTCGTGCCGCGGTGCAAGGGCCCGGCAT GCCC AGACCCGTACGGAAAAG A AAAAAGAGAAAAAGAAAGAAAAAG G L diversifolia 3a TCGATGCCCCGCAACAA GAGTGACCCGCAAAC CGGTTGGCAGAAGCACCGGGCGGGGGGCCGCCG AGGCGCCCTCCCCCGCGCG CCGCGGGCGCGGCCTGCGCTGACGCGGAGGCCCAGCCCCCGGCCCCAACAA CCAATCCCGGCGCCGCAGGCGCCAAGGAAGAGCAAC GAA GCGAGCGCGCCGCTGGAC GGCCCGGG AACGGCGCCGGTGACCCAGCGTC GCGTCCTATGACATTTGCATCCGAAA CGACTCCCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCAGCGTCGCCACCGCCCATCCCCACGGGCGCGGCGGATGATGGCTTCC CGGGAGCCCCGTCTCCCGGCCTGCCGAAAGAGGGGCCCAACGTGGCGACCGCCACGAACCACGGTGGATGAGTGAGCTA CAAGCGCT CGAGGCCAAGGCGTGAGCGCGTCGTGCCGCGGTGCAAGGGCCCGGCAT GCCC AGACCCGTACGGAAAAG A AAAAAAAGAAAAAGAAAGAAAAAG G L retusa TCGATGCCCCGCAACAA GAGTGACCCGCGAAC CGGTTGGCAGAAGCACCGGGCG CCGTGGGCGCGGCCTGCGCTGACGCGGAGGCCCAGCCCCCGGCCCCGACAA CCAATCCCGGCGCCGCAGGCGCCAAGGAAGAGCAAC GAA GCGAGCGCGCCGCTGGAC GGCCCGGG AACGGTGCCGGCGGCCCAGCGCT GCGTCTCATGACATTTGCA CCGAAAACGACTCTCGGCAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACGCCATTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCAGCGTCGCCGCCGCCCGTCCC ACGGGCGCGGCGGATGATGGCTTCC CGGGAGCCCCGTCTCCCGGCCTGCCGAAAATGGGGCCCAACGTGGCGACCGCCGCGATCCACGGTGGATGAGTGAGCCA CAGGCGCT CGAGGCCA GGCGTGAGCGCGTCGCGGCACGGTATA GGGGCCGGCAT GCGGGGCGTCCTGCAGGAGCGCCCCAGACTCGTACGGA A A AAAAAAGAAAAAAAGAGGAAGAAGAA L greggii TCGATGCCCCGCAACAA GAGTGACCCGCGAAC CGGTTGGCAGAAGCACCGGGCGGGGGGCC GCCCCCGACCCCAACAA CCAATCCCGGCGCCGCAGGCGCCAAGGAAGAGCAAC GAA GCGAGCGCGCCGCTGGAC GGCCCGGG AACGGTGCCGGTGACCCAGCGTC GCGTCTTAWGGCATTTGCCACCAAAA CGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCAACGTCGCCACCGCCCATCCC ACGGGCGCGGCGGATGATGGCTTCC CGGGAGCCCCGTCTCCCGGCCTGCCGAAAAAGGGGCCCAACGTGGCGACCGCCACGATCCACGGTGGATGAGTGAGCTA CAGGCGCT CGAGGCCA GGCGTGAGCGCGTCGTGCCACGGTACAAGGGGCCGGCAT GCGGGGCCTCCTGCAGGAGCGCCCCAGACTCGTACGGAAA A AA AAGAAAAAGAGAGGAAAAAGAA L diversifolia 8a TCGATGCCCCGCAACAA GAGTGACCCGCGAAC CGGTTGGCAGAAGCACCGGGCGGGGGGCCGTCG AGGCGCCCTCCCCCGCGCG CCGCGGGCGCGGCCTGCGCTGACGCGGAGGCCCAGCCCCCGGCCCCAACAA CCAATCCCGGCGCCGCAGGCGCCAAGGAAGAGCAAC GAA GCGAGCGCGCCGCTGGAC GGCCCGGG AACGGCGCCGGTGACCCAGCGTC GCGTCCTATGACATTTGCATCCGAAA CGACTCCCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCAGCGTCGCCACCGCCCATCCCCACGGGCGCGGCGGATGATGGCTTCC CGGGAGCCCCGTCTCCCGGCCTGCCGAAAGAGGGGCCCAACGTGGCGACCGCCACGAACCACGGTGGATGAGTAAGCTA CAAGCGCT CGAGGCCAAGGCGTGAGCGCGTCGTGCCGCGGTGCAAGGGCCCGGCAT GCCC AGACCCGTACGGAAAAG A AAAAAAAGAAAAAGAAAGAAAAAG G L diversifolia 1a TCGATGCCCCGCAACAA GAGTGACCCGCGAAC CGGTTGGCAGAAGCACCGGGCGGGGGGCCGTCG AGGCGCCCTCCCCCGCGCG CCGCGGGCGCGGCCTGCGCTGACGCGGAGGCCCAGCCCCCGGCCCCAACAA CCAATCCCGGCGCCGCAGGCGCCGAGGAAGAGCAAC GAA GCGAGCGCGCCGCTGGAC GGCCCGGG AACGGCGCCGGTGACCCAGCGTC GCGTCCTATGACATTTGCATCCGAAA CGACTCCCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCAGCGTCGCCACCGCCCATCCCCACGGGCGCGGCGGATGATGGCTTCC CGGGAGCCCCGTCTCCCGGCCTGCCGAAAGAGGGGCCCAACGTGGCGACCGCCACGAACCACGGTGGATGAGTGAGCTA CAAGCGCT CGAGGCCAAGGCGTGAGCGCGTCGTGCCGCGGTGCAAGGGCCCGGCAT GCCC AGACCCGTACGGAAAAG A AAAAAAAGAAAAAGAAAGAAAAAG G L diversifolia 6a CGATGCCCCGCAACAA GAGTGACCCGCGAAC CGGTTGGCAKAAGCACCGGGCGGGGGGCCGCCG AGGCGCCCTCCCCCGCGCG CCGCGGGCGCGGCCTGCGCTGACGCGGAGGCCCAGCCCCCGGCCCCAACAA CCAATCCCGGCGCCGCAGGCGCCAAGGAAGAGCAAC GAA GCGAGCGCGCCGCTGGAC GGCCCGGG AACGGCGCCGGTGACCCAGCGTC GCGTCCTATGACATTTGCATCCGAAA CGACTCCCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCAGCGTCGCCACCGCCCATCCCCACGGGCGCGGCGGATGATGGCTTCC CGGGAGCCCCGTCTCCCGGCCTGCCGAAAGAGGGGCCCAACGTGGCGACCGCCACGAACCACGGTGGATGAGTGAGCTA CAAGCGCT CGAGGCCAAGGCGTGAGCGCGTCGTGCCGCGGTGCAAGGGCCCGGCAT GCCC AGACCCGTACGGAAAAG A AAAAAAAGAAAAAGAAAGAAAAAG G L diversifolia 9a TCGATGCCCCGCAACAA GAGTGACCCGCGAAC CGGTTGGCAGAAGCACCGGGTGGGGGGCCGCCG AGGCGCCCTCCCCCGCGCG CCGCGGGCGCGGCCTGCGCTGACGCGGAGGCCCAGCCCCCGGCCCCAACAA CCAATCCCGGCGCCGCAGGCGCCAAGGAAGAGCAAC GAA GCGAGCGCGCCGCTGGAC GGCCCGGG AACGGCGCCGGTGACCCAGCGTC GCGTCCTATGACATTTGCATCCGAAA CGACTCCCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCAGCGTCGCCACCGCCCATCCCCACGGGCGCGGCGGATGATGGCTTCC CGGGAGCCCCGTCTCCCGGCCTGCCGAAAGAGGGGCCCAACGTGGCGACCGCCACGAACCACGGTGGATGAGTGAGCTA CAAGCGCT CGAGGCCAAGGCGTGAGCGCGTCGTGCCGCGGTGCAAGGGCCCGGCAT GCCC AGACCCGTACGGAAAAG A AAAAAAAGAAAAAGAAAGAAAAAG G L leucocephala ssp glabrata 6a CCGATGCCCCGCAACAA GAGCGACCCGTGAAC CGGTTGGCAGAAGCACCGGGCGGGGGGCCGACG AGGCGCCCTCCCCCGCGCG CCGCGGTCGCGGCCTGCGCTGACGCGGAGGCCCAGCCCC GGCCCCAACAA CCAATCCCGGCGCCGCAGGCGCCAAGGAAGAGCAAC GAA GCGAGCGCGCCGCTGGAC GGCCCGGG AACGGCGCCGGTGACCCAGCGTC GCGTCCTATGACATTTGCATCCGAAA CAACTCCCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCAGCGTCGCCACCGCCCTTCCCCAGGGGCGCGGCGGATGATGGCTTCC CGGGAGCCCCGTCTCCCGGCCTGCCGAAAGAGGGGCCCAACGTGGCGACCGCCACGAACCACGGTGGATGAGTGAGCTA CAAGCGCT CGAGGCCAAGGCGTGAGCGCGTCGTGCCGCGGTGCAAGGGCCCGGCAT GCCC AGACCCGTACGGAAAAG A AAAAAGAGAAAAAGAAAGAAAAAG G L leucocephala ssp glabrata 6b TCGATGCCCCGCAACAC GTGTGACCCGTAAAC TGGTTGACAGAAGCACTAGGCGGGGGGCCGCCG GATGTGCCCTCACCTGCGCA CTGTGGATGCGGCCTACGCTGACGTAGAGGCCCAGCCCCAAGACCCAACAA CCAATCCTAGCACCGTAGGCGCCAAGGAAGAGCAAC GA GAGAGCAAGACGCTGGAC GGCCCGGG AACGGCGCTGGTGACCTAGCGTT GCATCTTATGACATTTGTATCCAAAA TAACTCTCGACAATGGATATCTCGGCTCTCACATCGATGAAGAATGTAGTGAAATGTGATACTTGGTGTGAATTACAAAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACGCCATTAGGCCGAGGGAACGTCTACCTAGGTATCATGCGACATCGCCATCGCCTATCCC ACGGGCGCGGTTGATGATGGCTTCC TGGGAGCCTTGTCTCCTGGCCTGCCAAAAAAGGGGCCCAACGTGGGGACCGTCACGATCCATGGTGGATGAGTGAGCTA TAAGCGCT CGAGGCCAAGGAGTGAGCGCGTCGTACCGCGGTGTAAGGCGCGGGCAT GTCC AGACCCATACGGAAAAAGAAAAAAAAAGAGAAAGAGAGAAAAAG G L leucocephala ssp glabrata 5b TCGATGCCCCGCAACAC GTGTGACCCGTAAAC TGGTTGGCAGAAGCACTAGGCGGGGGGCCGCCG GAGGTGCCCTCACCTGCKCA CCGTGGACGCGBCCTACKCTGACGTAKAGGCCCAGCCCCAAGACCCAACAA CCAATCCTAGCACCGTAGGCGCCAAKGAAGAGCAAC GA GAGAGCAAGACGCTGGAC GGCCCGGG AACGGCGCTGGTGACCCAGCGTT GCGTCTTATGACATTTGCATCCAAAA TAACTCTCGACAATGGATATCTCGGCTCTCACATTGATGAAGAATGTAGTGAAATGTGATACTTGGTGTGAATTACAAAATCCCGTGAACCATCGAGTCTTTGAACTCAAGTTGCGCCCGACACCATTAGGCCGAGGGAACGWMTACCTGGGTATCATGCGACATCGCCATCGCCTATCCC ACGGGCGCGGTTGATGATGGCTTCC TGGGAGCCTTGTCTCCTGGCCTGCCAAAAAAGGGGCCCAACGTGGGGACCGTCACGATCCATGGTGGATGAGTGAGCTA TAAGCACT CGAGGCCAAGGAGTGAGCGCGTCGTGCCGCGGTGTAAGGCGCGGGCAT GTCC AGACCCGTACGGAAAAAGAAAAAAAAAGAGAAAGAGAGAAAAAG G L leucocephala ssp glabrata 8a TCGATGCCCCGTAACAC GTGTGACCCGTAAAC TGGTTGGCAGAAGCACTAGGCGGGGGGCCGCCG GAGGTGCCCTCACCTACGCA CCGTGGACGCAGCCTACGCTGACGTAGAGGCCCAGCCCCAAGTCCCAACAA CCAATCCTAGCACCGTAGGCGCCAAGGAAGAGCAAC GA GAGAGCAAGACGCTGGAC GGCCCGGG AACGGCGCTGGTGACCCAGCGTT GCGTCTTATGACATTTGCATCCAAAA TAACTCTCGACAATGGATATCTCGGCTCTCACATCGATGAAGAATGTAGTGAAATGTGATACTTGGTGTGAATTACAAAATCCCGTGAACCATCGAGTCTTTGAACGTAAGTTGCGCCCGACGCCATTAGGCCGAGGGAACGTCTACCTGGGTATCATGCGACATCGCCATCGCCTATCCC ACGGGCGCGGTTGATGATGGCTTCC TGGGAGCCTTGTCTCCTGGCCTGCCAAAAAAGGGGCCCAACGTGGGGACCGTCACGATCCATGGTGGATGAGTGAGCTA TAAGCACT CGAGGCCAAGGAGTGAGCGCGTCGTGCCGCGGTGTAAGGCGCGGGCAT GTCC AGACCCGTACGGAAAAAGAAAAAAAAAGAGAAAGAGAGAAAAAG G L pulverulenta 2a TCGATGCCCCGCAACAC GTGTGACCCGTAAAC TGGTTGGCAGAAGCACTAGGCGGGGGGCCGCCG KAGGTGCCCTCACCTGCGCA CCGTGGACGCGGCCTACGCTGACGTAGAGGCCCATCCCCAAGACCCAACAA CCAATCCTAGCACCGTAGGCGCCAGGGAAGAGCAAC GA GAGAGCAAGACGCTGGAC GGCCCGGG AACGGCGCTGGTGACCCAGCATT GCGTCTTATGACATTTGCATCCAAAA TAACTCTCGACAATGGATATCTCGGTTCTCACATCGATGAAGAATGTAGTGAAATGTGATACTTGGTGTGAATTACCAAATCCCGTGAACCATCGAGTCTTTGAACTCAAGTTGCGCCCGACGCCATTAGGCCGAGGGAACGTCTACCTGGGTATCATGCGACATCGCCATCGCCTATCCC ACGGGAGCGGTTGATGATGGCTTCC TGGGAGCCTTGTCTCCTGGCCTGCCAAAAAAGGGGCCCAACGTGGGGACCGTCACGATCCATGGTGGATGAGTGAGCCA TAAGCACT CGAGGCCAAGGAGTGAGCGCGTCGTGCCGCAGTGTAAGGCGCGGGCAT GTCC AGACCCGTASGGAAAAAGAAAAAAAAAGAGAAAGAGAGAAAAAG G L pulverulenta 1a TCGATGCCCCGCAACAC GTGTGACCCGTAAAC TGGTTGACAGAAGCACTAGGCGGGGGGCCGCCG GATGTGCCCTCACCTGCGCA CTGTGGATGCGGCCTACGCTGACGTAGAGGCCCAGCCCCAAGACCCAACAA CCAATCCTAGCACCGTAGGCGCCAAGGAAGAGCAAC GA GAGAGCAAGACGCTGGAC GGCCCGGG AACGGCGCTGGTGACCTAGCGTT GCATCTTATGACATTTGCATCCAAAA TAACTCTCGACAATGGATATCTCGGCTCTCACATCGATGAAGAATGTAGTGAAATGTGATACTTGGTGTGAATTACAAAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACGCCATTAGGCCGAGGGAACGTCTACCTAGGTATCATGCGACATCGCCATCGCCTATCCC ACGGGCGCGGTTGATGATGGCTTCC TGGGAGCCTTGTCTCCTGGCCTGCCAAAAAAGGGGCCCAACGTGGGGACCGTCACGATCCATGGTGGATGAGTGAGCTA TAAGCGCT

    Original URL path: http://ajbsupp.botany.org/v89/hughes-matrix3.txt (2016-02-14)
    Open archived version from archive



  •