archive-org.com » ORG » M » METABARCODING.ORG

Total: 246

Choose link from "Titles, links and description words view":

Or switch to "Titles and links view".
  • HTTP 302
    HTTP 302 If you are not automatically redirected click here to continue

    Original URL path: http://metabarcoding.org/spip.php?action=converser&redirect=spip.php%3Fpage%3Dlogin%26url%3Dspip.php%253Frubrique1 (2016-04-26)
    Open archived version from archive


  • HTTP 302
    HTTP 302 If you are not automatically redirected click here to continue

    Original URL path: http://metabarcoding.org/spip.php?action=converser&redirect=spip.php%3Fpage%3Dlogin%26url%3Dspip.php%253Frubrique24 (2016-04-26)
    Open archived version from archive

  • Designing a new DNA metabarcode for fish
    Loading the data fish read ecopcr result Teleostei 04 vert ecopcr taxo read taxonomy ncbi20150518 A brief look into the ecoPCR result head fish n 2 AC seq length taxid rank species species name 1 NC 013146 16960 100858 species 100858 Threskiornis aethiopicus 2 NC 016427 16379 82464 species 82464 Myodes regulus genus genus name family family name superkingdom 1 100857 Threskiornis 33574 Threskiornithidae 2759 2 447134 Myodes 337677 Cricetidae 2759 superkingdom name strand forward match forward mismatch forward tm 1 Eukaryota D ATACCGCCCGTCACCCTC 2 45 64 2 Eukaryota D ACACCGCCCGTCACCCTC 1 53 84 reverse match reverse mismatch reverse tm amplicon length 1 CTAAGTGCACATTCCGGT 2 45 55 74 2 CCAAGCACACTTTCCAGT 4 16 28 79 sequence 1 CTCATAAGCTACTGACTCCCATAACTAATACCCTAATTAGCCGAAGATGAGGTAAGTCGTAACAAGGTAAGTGT 2 CTCAAACTAAATAAATGAGATCTATACATAATTACATCAAACTTTTACGAGAGGAGATAAGTCGTAACAAGGTAAGCAT definition 1 Threskiornis aethiopicus mitochondrion complete genome 2 Myodes regulus mitochondrion complete genome Identifying which sequences belongs fish teleo taxid ecofind taxo Teleostei teleo taxid 1 32443 is a fish is subcladeof taxo fish taxid teleo taxid table is a fish is a fish FALSE TRUE 1673 1577 Testing the conservation of the priming sites Fish forward ecopcr forward shanon ecopcr fish group is a fish Fish reverse ecopcr reverse shanon ecopcr fish group is a fish latex H sum i in A C G T p i times frac log p i log 2 Ploting the results par mfcol c 2 2 dnalogoplot Fish forward TRUE primer ACACCGCCCGTCACTCTC main Forward Fish dnalogoplot Fish forward FALSE primer ACACCGCCCGTCACTCTC main Forward not Fish dnalogoplot Fish reverse TRUE primer CCAAGTGCACCTTCCGGT main Reverse Fish dnalogoplot Fish reverse FALSE primer CCAAGTGCACCTTCCGGT main Reverse not Fish How mismatches influence taxonomical selection par mfcol c 1 1 mismatchplot fish group is a fish legend c Not a fish Fish What is the taxonomic resolution of our marker only fish fish is a fish res resolution taxo only fish resolution with only fish unique data frame species name taxid rank res t t sort table resolution rank length resolution rank decreasing TRUE 1 species 0 780177891 genus 0 116264295 family 0 071791614 no rank 0 010165184 subfamily 0 008894536 tribe 0 006988564 subspecies 0 005717916 Is it the same for Cyprinideae is a cyprinidae is subcladeof taxo fish taxid 7953 only cyprinidae fish is a cyprinidae res resolution taxo only cyprinidae resolution with only cyprinidae unique data frame species name taxid rank res t t sort table resolution rank length resolution rank decreasing TRUE 1 species 0 66563467 family 0 26006192 genus 0 06811146 subspecies 0 00619195 And consequently for other fish no cyprinidae fish is a fish is a cyprinidae res resolution taxo no cyprinidae resolution with no cyprinidae unique data frame species name taxid rank res t t sort table resolution rank length resolution rank decreasing TRUE 1 species 0 810551559 genus 0 128697042 family 0 029576339 subfamily 0 011191047 tribe 0 008792966 no rank 0 005595524 subspecies 0 005595524 Go back to Unix We try to select marker specific of Cyprinidae ecofind d ncbi20150518 cyprinidae opening ncbi20150518 database Reading 1283820 taxa No local taxon 1283820

    Original URL path: http://metabarcoding.org/IMG/html/primerdesign.html (2016-04-26)
    Open archived version from archive

  • PUSCAS Mihai - metabarcoding.org
    address Required Subject Required Text of your message Required Please leave this field empty Twitter Metabarcoding Editorial board BRANDNER Melissa University of Nordland Bodø Norway BROCHMANN Christian National Centre for Biosystematics Oslo Norway CHARITON Anthony CSIRO Land and Water Lucas Heights NA Australia DEAGLE Bruce University of Victoria Victoria Canada Eric Coissac LECA Grenoble France KASAPIDIS Panagiotis Hellenic Center for Marine Research Irakleion Crete Greece PAWLOWSKI Jan Université de Genève Genève 4 Switzerland TABERLET Pierre LECA Grenoble France WILLERSLEV Eske Centre for GeoGenetics Copenhagen Denmark Editorial Vodka Bison and Metabarcoding 31 July 2015 by BRANDNER Melissa The start of last month saw the occurrence of the Fifth Metabarcoding Spring School held in Białowieża National Park Poland A variety of scientists attended from all over the globe to learn share and inspire with unique stories of metabarcoding The scientists at the Mammal Research Institute PAS in Białowieża National Park hosted this year s workshop And our hats go off to them for the organizational skills warmth and hospitality During the week experienced metabarcoders gave lectures on their trials and tribulations in the field of metabarcoding sparking conversations between the attendees The end of the first day saw flash talks from all

    Original URL path: http://metabarcoding.org/spip.php?auteur80&debut_auteurs=20 (2016-04-26)
    Open archived version from archive

  • HTTP 302
    HTTP 302 If you are not automatically redirected click here to continue

    Original URL path: http://metabarcoding.org/spip.php?action=converser&redirect=spip.php%3Fpage%3Dlogin%26url%3Dspip.php%253Frubrique22 (2016-04-26)
    Open archived version from archive

  • HTTP 302
    HTTP 302 If you are not automatically redirected click here to continue

    Original URL path: http://metabarcoding.org/spip.php?action=converser&redirect=spip.php%3Fpage%3Dlogin%26url%3Dspip.php%253Frubrique20 (2016-04-26)
    Open archived version from archive

  • HTTP 302
    HTTP 302 If you are not automatically redirected click here to continue

    Original URL path: http://metabarcoding.org/spip.php?action=converser&redirect=spip.php%3Fpage%3Dlogin%26url%3Dspip.php%253Frubrique19 (2016-04-26)
    Open archived version from archive

  • ANDERSEN Kenneth - metabarcoding.org
    Required Subject Required Text of your message Required Please leave this field empty Twitter Metabarcoding Editorial board BRANDNER Melissa University of Nordland Bodø Norway BROCHMANN Christian National Centre for Biosystematics Oslo Norway CHARITON Anthony CSIRO Land and Water Lucas Heights NA Australia DEAGLE Bruce University of Victoria Victoria Canada Eric Coissac LECA Grenoble France KASAPIDIS Panagiotis Hellenic Center for Marine Research Irakleion Crete Greece PAWLOWSKI Jan Université de Genève Genève 4 Switzerland TABERLET Pierre LECA Grenoble France WILLERSLEV Eske Centre for GeoGenetics Copenhagen Denmark Editorial Vodka Bison and Metabarcoding 31 July 2015 by BRANDNER Melissa The start of last month saw the occurrence of the Fifth Metabarcoding Spring School held in Białowieża National Park Poland A variety of scientists attended from all over the globe to learn share and inspire with unique stories of metabarcoding The scientists at the Mammal Research Institute PAS in Białowieża National Park hosted this year s workshop And our hats go off to them for the organizational skills warmth and hospitality During the week experienced metabarcoders gave lectures on their trials and tribulations in the field of metabarcoding sparking conversations between the attendees The end of the first day saw flash talks from all participants

    Original URL path: http://metabarcoding.org/spip.php?auteur16&debut_auteurs=20 (2016-04-26)
    Open archived version from archive



  •